Helicotylenchus species are ecto and semiendoparasitic nematode, with worldwide distribution and with great importance in crops of Musa spp., as it causes the highest losses of production and yield after Radopholus similis, Pratylenchus spp., and Meloidogyne spp. (Araya and De Waele, 2004; Karakas, 2007; Singh et al., 2013; Ravichandra, 2014). The most limiting Helicotylenchus species in banana and plantain crops around the world are H. multicinctus (Golden, 1956), H. dihystera (Sher, 1961), and H. erythrinae (Golden, 1956). However, other species of Helicotylenchus have been found to be associated with Musa spp. crops in minor frequency. These species include H. abunaamai (Siddiqi, 1972), H. incisus, H. africanus, H. punicae, H. egyptiensis, H. variocaudatus (Fortuner, 1984), and H. digonicus (Perry et al., 1959; Castillo and Gómez-Barcina, 1993; Van Den Berg et al., 2003; Khan and Hasan, 2010; Ravichandra, 2014).
These species occur individually or in a mixture associate with Musaceae of different production zones in the world, including Vietnam, Venezuela, Democratic Republic of Congo, Brazil, South Africa, India, Mexico, and Greece. These nematodes cause injuries to outer layers of cortical tissue (observed as brown–reddish to black discrete spots), as well as disruption and progressive deterioration of the roots system and, as a consequence, the plant’s capacity for the uptake of water and nutrients is affected negatively (Orbin, 1973; Ngoc Chau et al., 1997; Crozzoli, 2009; Dias-Arieira, 2010; Khan and Hasan, 2010; Kamira et al., 2013; Roy et al., 2014; Daneel et al., 2015; Lara et al., 2016; Tzortzakakis et al., 2017). In addition, bunch maturation and size are reduced, with production losses between 19 and 34% at 2 to 3 years after planting, although the damage may be greater when R. similis is absent (McSorley and Parrado, 1986; Barekye et al., 2000; Guzmán-Piedrahita, 2011; Selvaraj et al., 2014).
Production losses in plantain and banana by Helicotylenchus spp. depend on two main factors. On the one side, the susceptibility of planting material and nematode density, because differences in the population level of H. multicinctus have been registered among Musa spp. cultivars with a high correlation between its density and the necrotic and dead roots percentage (Speijer and Ssango, 1999). On the other hand, losses depend on environmental conditions, since Helicotylenchus spp. are predominant in crops cultivated between 1,000 and 1,350 meters above sea level in andisols and vertisols soils with high contents of Ca, P, Mn and reduced organic matter (Speijer and Ssango, 1999; Karakas, 2007; Araya et al., 2011).
Although Helicotylenchus has been reported in the banana and plantain crops of Colombia and Brazil, morphological, morphometric, and molecular data are scarce for these geographical regions (Zuñiga et al., 1979; Villegas, 1989; Guzmán-Piedrahita and Cataño-Zapata, 2004; Torrado-Jaime and Castaño-Zapata, 2009). In order to contribute to the knowledge of the taxonomic identity of the species of Helicotylenchus associated with Musaceae in Colombia and Brazil, the present study has the following objectives: (i) to identify the species of Helicotylenchus that are associated with banana and plantain crops, using a combination of morphological, morphometric, and molecular analysis, and (ii) to elucidate the phylogenetic relationships of Helicotylenchus species that are associated with banana and plantain crops in the departments of Quindío, Risaralda y Valle del Cauca in Colombia and Minas Gerais in Brazil.
Root and soil samples were collected from banana and plantain rhizosphere crops in the departments of Quindío (Calarcá and Córdoba municipalities), Risaralda (La Celia municipality), and Valle del Cauca (Palmira and Buenaventura municipalities) in Colombia and in Janauba, Minas Gerais state, Brazil during 2015 to 2018. In each crop, compound samples were collected, comprising 15 to 20 plants/ha. Nematodes were extracted from roots and soil using a modification of Cobb’s method (Ravichandra, 2014). Afterwards, representative populations of Helicotylenchus were selected for posterior analysis in the microbiology and molecular biology laboratories of the National University of Colombia (Palmira, Valle del Cauca, Colombia) and the Laboratory of Nematology of the Biological Institute (Campinas, São Paulo, Brazil).
Nematodes extracted and identified as Helicotylenchus were killed with heat at 60°C for 4 min and fixated in 2% formalin. Semipermanent preparations were made and morphometric data were registered following Boag and Shamim Jairajpuri (1985) and Uzma et al. (2015). Microphotographs were taken using a compound microscope equipped with differential interference contrast–DIC (DM2500, Leica, Germany).
Morphometric data were analyzed using the Community Analysis Package (PISCES Conservation Ltd, Lymington UK, 1995) with principal components analysis (PCA) and conglomerate analysis to determine groupings and evaluate those characters that could discriminate species.
For molecular analysis, DNA was extracted by the Proteinase K method of Múnera et al. (2009) with modifications. A single nematode was crushed with a sterile scalpel and transferred to an Eppendorf tube with 15 µl of worm lysis buffer (50 mM KCl, 10 mM Tris pH 8.0, 15 mM MgCl2, 0.5% Triton x–100, 4.5% Tween–20, 0.09% Proteinase K). The tubes were incubated at −80°C (15 min), 65°C (1 h), and 95°C (15 min), centrifuged to 16,000 g (1 min) and stored at −20°C. Amplification of D2 to D3 expansion segment of the large subunit – LSU of ribosomal DNA (28S) was done using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCCTCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999). The PCR conditions were initial denaturation during 2 min at 94°C followed by 40 cycles of 45 s at 94°C, 45 s at 55°C, and 1 min at 72°C and final extension of 10 min at 72°C. PCR products were sequenced in both directions at BIONNER Korea.
Consensus sequences were edited using the software Geneious (Kearse et al., 2012) and BLAST (Basic Local Alignment Search Tool) at NCBI (National Center for Biotechnology Information) was used to confirm the species’ identity of the sequences. To estimate the phylogenetic history of Helicotylenchus, D2 to D3 sequences of others specimens of the species were downloaded from GenBank, including a sequence of Rotylenchus magnus, which was used as outgroup. Sequence alignment was performed using MAFFT v7 (Katoh et al., 2002) (protocol Q-INS-i), and jModelTest v2.1.7 (Posada, 2008) to find the best nucleotide substitution model, based on the Akaike information criterion corrected for small sample sizes. Afterwards maximum likelihood (ML) was used to estimate a tree with 250 bootstraps and the general time reversible model with allowance for gamma distribution of rate variation (GTR+Γ) in RAxML v8 (Stamatakis, 2014). The phylogeny of Helicotylenchus was inferred using MrBayes v3.2.6 (Ronquist et al., 2012) with the GTR + Γ model. Two independent Metropolis-coupled Markov chain Monte Carlo (MCMCMC) searches were performed for 2 million generations sampling every 2,000 steps. Convergence was assessed using Tracer v1.5 (burn-in = 20% of the samples), and by examining the average standard deviation of split frequencies among parallel chains. The consensus tree was calculated from the posterior distribution of 1,600 phylogenies. The Bayesian analysis was performed in the CIPRES Science Gateway (Miller et al., 2010).
Four species of Helicotylenchus were identified in the study areas: H. multicinctus, H. dihystera, H. erythrinae, and H. californicus. Morphological and morphometric data from each species closely resembled type and reference populations species (Tables 1-4).
Morphometric data of H. multicinctus and reference populations.
| Species | H. multicinctus | H. multicinctus | H. multicinctus | H. multicinctus | H. multicinctus | H. multicinctus |
|---|---|---|---|---|---|---|
| Locality/publication | Plantain, Cordoba–Quindío–HM1 | Plantain, Rozo–Palmira–HM2 | Banana, Brazil HM3–* | Banana, Brazil 233–HM4 |
Goodey (1940), Golden (1956) |
Uzma et al. (2015) |
| L | 0.6 ± 0.1 (0.4–0.8) | 0.6 ± 0.04 (0.5-0.7) | 0.5 ± 0.05 (0.5-0.6) | 0.5 ± 0.1 (0.4-0.6) | 0.54 (0.46-0.68) | 0.47-0.53 |
| a | 26.1 ± 2.8 (22.5-31.1) | 24.4 ± 1.5 (22.1-27.4) | 24.7 ± 1.9 (22.4-30.3) | 24.5 ± 2.0 (21.2-27.9) | 24.47 (23.8-28.5) | 24.0-30.0 |
| c | 45.6 ± 5.1 (36.1-55.2) | 44.6 ± 5.6 (36.5-59.8) | 49.2 ± 7.0 (37.7-64.1) | 50.7 ± 7.4 (39.6-69.6) | 53.8 (48.0-63.0) | 35.0-46.0 |
| c′ | 0.9 ± 0.1 (0.7-1.1) | 0.9 ± 0.1 (0.7-1.0) | 0.8 ± 0.1 (0.6-1.1) | 0.8 ± 0.1 (0.4-1.0) | 0.8-1.0 | 0.8-1.0 |
| V% | 68.4 ± 1.6 (65.9-71.7) | 67.2 ± 1.7 (64.1-70.0) | 68.9 ± 2.3 (65.0-73.1) | 69.1 ± 1.1 (66.2-71.1) | 69.0 (64.6-71.8) | 65.0-69.0 |
| DGO | 8.6 ± 0.6 (8.0-10.0) | 9.5 ± 0.5 (9.0-10.0) | 9.1 ± 1.0 (7.0-11.0) | 9.3 ± 1.1 (7.0-11.0) | – | – |
| Stylet length | 23.4 ± 1.3 (21.0-26.0) | 23.7 ± 0.7 (23.0-25.0) | 23.5 ± 0.9 (22.0-25.0) | 23.1 ± 0.8 (22.0-24.0) | 20.0-24.0 | 22.0-24.0 |
| Number of head annuli | 4.0 ± 0.6 (3.0-5.0) | 4.0 ± 0.5 (4.0-5.0) | 4.0 ± 0.5 (4.0-5.0) | 4.0 ± 0.0 (4.0-4.0) | 3.0-5.0 | 3.0-4.0 |
| Tail length | 13.0 ± 1.9 (10.0-16.0) | 12.9 ± 1.2 (10.0-15.0) | 11.3 ± 1.7 (8.0-15.0) | 10.5 ± 1.9 (7.0-15.0) | – | – |
| Number of tail annuli | 9.0 ± 1.2 (7.0-12.0) | 9.3 ± 1.3 (7.0-12.0) | 8.0 ± 1.9 (5.0-12.0) | 7.7 ± 1.5 (5.0-10.0) | 6.0-13.0 | 6.0-12.0 |
| Position of phasmid | 3.0 ± 1.2 (2.0-6.0) | 3.8 ± 1.0 (3.0-6.0) | 5.0 ± 2.1 (2.0-7.0) | 5.0 ± 1.2 (3.0-7.0) | 1.0-6.0 | 2.0-6.0 |
Note: Measurements in µm; mean ± s.d. (range), except for L in mm.
Morphometric data of H. californicus and reference populations.
| Species | H. californicus | H. californicus | H. californicus | H. californicus | H. californicus |
|---|---|---|---|---|---|
| Locality/publication | Plantain, Delfina–Buenaventura–HC1 | Banana, Brazil HC2 |
Van Den Berg and Heyns (1975) |
Uzma et al. (2015) |
Sher (1966) |
| L | 0.6 ± 0.05 (0.5-0.6) | 0.6 ± 0.1 (0.5-0.7) | 0.7 (0.6-0.8) | 0.58-0.78 | 0.6 (0.5-0.7) |
| a | 23.5 ± 1.0 (22.0-25.2) | 24.6 ± 1.4 (21.5-26.6) | 28.8 (23.4-35.0) | 27-32 | 24.1 (21.1-26.2) |
| c | 35.5 ± 4.7 (27.2-45.8) | 34.9 ± 3.0 (30.3-40.2) | 39.0 (30.8-53.0) | 32.0-50.0 | 38.7 (31.2-48.1) |
| c′ | 1.0 ± 0.1 (0.8-1.1) | 1.1 ± 0.1 (1.0-1.3) | 1.1 (0.7-1.5) | 0.8-1.3 | 1.2 (0.9-2.1) |
| V% | 62.1 ± 1.7 (59.3-64.8) | 65.6 ± 3.0 (61.3-75.5) | 63.0 (60.0-64) | 59-64 | 64 (60-67) |
| DGO | 11.4 ± 1.2 (10.0-14.0) | 11.4 ± 2.4 (8.0-14.0) | – | – | 10 (8-14) |
| Stylet length | 22.4 ± 0.9 (20.0-23.0) | 23.5 ± 1.0 (21.0-25.0) | 24.1 (22.8-27.2) | 24-27 | 27 (26-29) |
| Number of head annuli | 4.7 ± 0.7 (4.0-6.0) | 4.2 ± 0.5 (4.0-6.0) | 3.0-5.0 | 4 | 5-7 |
| Tail length | 15.9 ± 1.0 (13.0-19.0) | 16.5 ± 1.5 (14.0-20.0) | 17.9 (15.1-25.0) | – | 16 (13-21) |
| Number of tail annuli | 7.8 ± 1.1 (6.0-9.0) | 7.8 ± 0.9 (6.0-9.0) | 10.0-17.0 | 8 | 9 (6-12) |
| Position of phasmid | 6.8 ± 1.3 (5.0-8.0) | 6.0 ± 2.7 (2.0-8.0) | 3.0-14.0 | 2 | 1-11 |
Note: Measurements in µm; mean ± s.d. (range), except for L in mm.
Helicotylenchus multicinctus populations were identified in plantain crops of Colombia (Córdoba, Quindío and Rozo, Valle del Cauca) and banana crops of Brazil (Minas Gerais). Morphologically, these populations show a habitus post-mortem open C form, a hemispherical cephalic region, the shape of the stylet knobs flattened anteriorly and rounded posteriorly, a rounded tail, functional spermatheca and males present (Fig. 1, Table 1).
Figure 1:
Helicotylenchus multicinctus. A: Habitus post-mortem of a female, B and C: Anterior region of female body, D and E: Posterior region of female body, F: Medium region of female body, G: Posterior region of male body. vu = Vulva, dgo = Dorsal esophageal Gland Orifice, an = Anus, lf = Lateral field, sptc = Spermatheca, spc = Spicule.
Populations of H. dihystera were founded in plantain and banana crops from Colombia (Córdoba, Quindío). Morphologically, the populations of this species show a habitus post-mortem with a spiral shape, a hemispherical cephalic region with the shape of stylet knobs indented or flattened anteriorly and rounded posteriorly, a conoide tail and males absent (Fig. 2, Table 2).
Morphometric data of H. dihystera and reference populations.
| Species | H. dihystera | H. dihystera | H. dihystera | H. dihystera | H. dihystera | |
|---|---|---|---|---|---|---|
| Locality/publication | Banana, Córdoba–Quindío–HD1 | Plantain, Córdoba–Quindío–HD2 | Sher (1961) | Uzma et al. (2015) | Wount and Yates | |
| n = 10 | n = 15 | n = 12 | n = not defined | n = 10 | n = 10 | |
| L | 0.62 ± 0.08 (0.53-0.77) | 0.61 ± 0.06 (0.48-0.69) | 0.67 (0.61-0.86) | 0.59-0.79 | 0.67 ± 0.05 (0.57-0.73) | 0.71 ± 0.04 (0.61-0.75) |
| a | 25.5 ± 1.94 (22.93-29.69) | 24.0 ± 1.83 (20.50-28.13) | 29.5 (26.0-34.0) | 27-35 | 29.3 ± 2.21 (26.0-33.0) | 29.5 ± 1.35 (27.0-32.0) |
| c | 43.8 ± 8.36 (25.12-55.45) | 45.3 ± 4.49 (39.0-56.3) | 48.0 (40.0-65.0) | 35- 49 | 46.0 ± 4.69 (37.0-53.0) | 43.0 ± 4.67 (35.0-50.0) |
| c′ | 1.0 ± 0.17 (0.80-1.31) | 0.9 ± 0.07 (0.71-0.94) | 1.0-1.3 | 0.8-1.2 | 1.11 ± 0.11 (1.0-1.3) | 1.09 ± 0.11 (0.9-1.3) |
| V% | 64.6 ± 1.19 (62.24-66.35) | 64.5 ± 1.24 (61.94-66.12) | 63.0 (60.0-66.0) | 60-65 | 65 ± 1.32 (63.0-67.0) | 63.0 ± 0.84 (61.0-64.0) |
| DGO | 14.7 ± 1.38 (13.0-16.0) | 14.9 ± 1.57 (13.0-17.0) | – | – | 11.5 ± 1.63 (8.5-13.5) | 10.0 ± 1.25 (7.0-11.0) |
| Stylet length | 24.4 ± 0.97 (23.0-26.0) | 23.8 ± 0.77 (23.0-25.0) | 26.0 (24.5-27.5) | 24-29 | 27.9 ± 1.08 (25.5-29.0) | 26.1 ± 0.74 (25.0-27.0) |
| Number of head annuli | 4.0 ± 0.0 (4.0-4.0) | 4.0 ± 0.26 (4.0-5.0) | 3.0-4.0 | 4-5 | – | – |
| Tail length | 14.5 ± 3.06 (11.0-21.0) | 13.5 ± 1.51 (12.0-16.0) | – | – | 14.5 ± 1.48 (12.0-17.0) | 16.7 ± 2.50 (12.0-21.0) |
| Number of tail annuli | 8.0 ± 1.88 (5.0-12.0) | 8.0 ± 0.68 (7.0-10.0) | 8-12 | 6-12 | – | – |
| Position of phasmid | 8.0 ± 0.99 (7.0-10.0) | 9.0 ± 1.91 (6.0-11.0) | 6-12 | 5-11 | – | – |
Note: Measurements in µm; mean ± s.d. (range), except for L in mm.
Figure 2:
Helicotylenchus dihystera, H. erythrinae, and H. californicus. A: Habitus post mortis of a female in H. dihystera, B: Anterior region of female body in H. dihystera, C: Posterior region of female body in H. dihystera, D: Habitus post mortis of a female in H. erythrinae, E: Anterior region of female body in H. erythrinae, F: Posterior region of female body in H. erythrinae, G: Spermatheca of female in H. erythrinae, H: Habitus post mortis of female in H. californicus, I and J: Anterior region of female body in H. californicus, K: Posterior region of female body in H. californicus with short ventral projection and sharply pointed tail, L: Posterior region of female body in H. californicus with short ventral projection and blunt tail, M: Posterior region of male body in H. californicus.
The populations identified as H. erythrinae occurred in Colombian plantain and banana crops (Calarcá, Quindío and La Celia, Risaralda). Morphologically, the populations of this species show a habitus post-mortem of a loose spiral, a hemispherical cephalic region with the shape of stylet knobs indented or flattened anteriorly and rounded posteriorly, a tail with a long ventral projection, females with functional spermatheca and males present (Fig. 2, Table 3).
Morphometric data of H. erythrinae and reference populations.
| Species | H. erythrinae | H. erythrinae | H. erythrinae | H. erythrinae | H. erythrinae | |
|---|---|---|---|---|---|---|
| Locality/publication | Banana, Calarcá–Quindío (La Julia)–HE1 | Plantain, Calarcá –Quindío (Resta)–HE2 | Van Den Berg and Heyns (1975) | Uzma et al. (2015) | Wount and Yates | |
| n = 15 | n = 25 | n = 7 | n = not defined | n = 10 | n = 10 | |
| L | 0.53 ± 0.1 (0.4-0.7) | 0.6 ± 0.1 (0.46-0.68) | 0.5 (04-0.6) | 0.48-0.61 | 0.87 ± 0.06 | 0.69 ± 0.05 |
| a | 25.03 ± 2.0 (22.7-29.7) | 25.90 ± 2.2 (22.86-30.91) | 25.1 (21.1-26.7) | 23.0-26.0 | 29.7 ± 1.64 (27.0-32.0) | 28.2 ± 1.87 (24.0-30.0) |
| c | 25.93 ± 4.1 (19.2-31.5) | 28.09 ± 3.0 (21.82-32.94) | 28.9 (23.3-30.3) | 27.0-34.0 | 43.0 ± 5.99 (31.0 -51.0) | 48.0 ± 10.55 (35.0-74.0) |
| c′ | 1.46 ± 0.2 (1.1-1.7) | 1.41 ± 0.15 (1.13-1.73) | 1.4 (1.3-1.4) | 1.0-1.6 | 1.13 ± 0.106 (1.0-1.3) | 1.03 ± 0.206 (0.60-1.30) |
| V% | 63.8 ± 1.8 (60.1-67.6) | 63.7 ± 2.16 (60.82-68.54) | 64.0 (61.0-67.0) | 60.0-65.0 | 62.0 ± 2.85 (58.0-68.0) | 63.0 ± 2.22 (59.0-65.0) |
| DGO | 10.36 ± 2.6 (5.0-8.0) | 12 ± 1.97 (8.0-15.0) | – | – | 9.6 ± 2.07 (75.0-13.0) | 9.1 ± 0.94 (7.0-10.0) |
| Stylet length | 22.7 ± 1.0 (21.0-25.0) | 22.8 ± 0.83 (21.0-24.0) | 24.6 (21.7-26.8) | 23.0-26.0 | 28.3 ± 1.23 (26.0-30.0) | 27.9 ± 0.97 (25.5-29.0) |
| Number of head annuli | 4.0 ± 0.0 (4.0-4.0) | 4.0 ± 0.32 (3.0-5.0) | 4.0 | 4.0-5.0 | – | – |
| Tail length | 20.53 ± 2.2 (17.0-25.0) | 20.65 ± 2.39 (17.0-26.0) | 17.9 | – | 20.6 ± 2.8 (16.0-24.0) | 14.7 ± 2.71 (9.0-18.0) |
| Number of tail annuli | 10.0 ± 2.8 (7.0-17) | 11.0 ± 1.01 (10.0-13.0) | 10.0-14.0 | 6.0-12.0 | 13.4 ± 0.97 (12.0-15.0) | 10.2 ± 2.25 (7.0-15.0) |
| Position of phasmid | 6.0 ± 0.9 (4.0-7.0) | 3.0 ± 1.01 (1.0-5.0) | 9 | 4/2 | – | – |
Note: Measurements in µm; mean ± s.d. (range), except for L in mm.
The species H. californicus was identified in a plantain crop from Colombia (Delfina–Buenaventura, Colombia) and a banana crop from Brazil (Minas Gerais). Morphologically, these populations presented a habitus post-mortem in a spiral, a hemispherical cephalic region with the shape of stylet knobs flattened anteriorly and rounded posteriorly, an irregular tail with a short sharply pointed or blunt ventral projection and males present (Fig. 2; Table 4).
PCA and conglomerate analysis separated the species into four groups (H. multicinctus, H. dihystera, H. erythrinae, and H. californicus) (Figs. 3, 4). The principal components 1 to 4 have eigenvalues greater than or equal to 1 and explain 91.39% of variance (Table 5). However, PC1 and PC2 axes better separated the species. In PC1, the most discriminating variables were maximum body diameter, the number of tail annuli, and ratio c′, while in PC2 they were vulva position, anal body diameter, and tail length (Table 6).
Eigenvalues and percent total variance accounted for each principal component.
| Principal component | Eigenvalues | Cumulative total | % of Total variance | Cum. % of total variance |
|---|---|---|---|---|
| 1 | 4.92 | 4.92 | 37.88 | 37.88 |
| 2 | 3.75 | 8.68 | 28.88 | 66.76 |
| 3 | 2.16 | 10.84 | 16.63 | 83.39 |
| 4 | 1.04 | 11.88 | 7.99 | 91.39 |
| 5 | 0.35 | 12.23 | 2.70 | 94.09 |
| 6 | 0.29 | 12.52 | 2.22 | 96.31 |
| 7 | 0.22 | 12.74 | 1.68 | 97.99 |
| 8 | 0.16 | 12.89 | 1.23 | 99.22 |
| 9 | 0.06 | 12.95 | 0.43 | 99.65 |
| 10 | 0.04 | 12.99 | 0.29 | 99.94 |
| 11 | 0.01 | 13 | 0.06 | 100 |
| 12 | 1.5128E–7 | 13 | 1.16369E–6 | 100 |
| 13 | –4.65844E–10 | 13 | –3.58342E–9 | 100 |
Correlations between the first four component principals and the morphometric parameters of females in Helicotylenchus spp.
| Vector | Diagnostic character | 1 | 2 | 3 | 4 |
|---|---|---|---|---|---|
| 1 | L | –0.25 | 0.21 | 0.02 | 0.66 |
| 2 | a | 0.09 | –0.01 | –0.57 | 0.35 |
| 3 | c | –0.34 | –0.33 | –0.01 | 0.02 |
| 4 | c′ | 0.36 | 0.28 | –0.12 | –0.11 |
| 5 | V % | –0.06 | –0.48 | –0.13 | 0.01 |
| 6 | DGO | –0.22 | 0.35 | –0.25 | –0.27 |
| 7 | Stylet length | –0.31 | –0.05 | –0.39 | –0.03 |
| 8 | Number of head annuli | 0.01 | 0.05 | 0.61 | 0.07 |
| 9 | Number of tail annuli | 0.37 | 0.07 | –0.09 | 0.33 |
| 10 | Position of phasmid | –0.29 | 0.31 | –0.09 | –0.40 |
| 11 | Maximum body diameter | –0.39 | 0.22 | 0.02 | 0.15 |
| 12 | Tail length | 0.32 | 0.35 | –0.10 | –0.05 |
| 13 | Anal body diameter | –0.24 | 0.37 | 0.17 | 0.22 |
Note: Key diagnostics for discriminating Helicotylenchus species are denoted in italic.
Figure 3:
Populations of H. multicinctus (HM), H. dihystera (HD), H. erythrinae (HE), and H. californicus (HC) from Colombia and Brazil can be assigned to its corresponding species based on morphometric data. The two first axes of a principal components analysis (PCA) are shown. HM1 to HM2 from Colombia and HM3 to HM4 from Brazil; HD1 to HD3 from Colombia; HE1 to HE3 from Colombia; and HC1 from Colombia and HC2 from Brazil.
Figure 4:
Dendrogram obtained by a conglomerates analysis to classify the Colombian and Brazilian populations of H. multicinctus (HM), H. dihystera (HD), H. erythrinae (HE), and H. californicus (HC). HM1 to HM2 from Colombia and HM3 to HM4 from Brazil; HD1 to HD3 from Colombia; HE1 to HE3 from Colombia; and HC1 from Colombia and HC2 from Brazil.
In relation to the D2 to D3 expansion segment of ribosomal DNA, four consensus sequences were obtained for H. multicinctus with similarity of 99% with different sequences of this species deposited in the NCBI (KF443214, DQ328745, DQ328746, HM014290, HM014291, and HM014292). On the other hand, two consensus sequences were obtained for H. dihystera, which presented similarity of 99% with other sequences of this species already deposited in NCBI (HM014251, KF486503, HM014250, HM014245, HM014246, HM014247, HM014248, HM014249, KM506834, KM506835, and KM506836). Molecular identity of the sequence obtained from the individual morphologically identified as H. erythrinae was not confirmed, because there are no reference sequences of H. erythrinae in NCBI or any other molecular database. When BLAST was performed, no sequence deposited in NCBI presented similarity greater than or equal to 99% with the sequence obtained in this research for H. erythrinae and closer sequences were of H. labiodiscinus with a similarity of 90.85 to 91.03% (HM014293; HM014294; HM014295). For individuals identified morphologically as H. californicus were obtained four sequences that showed similarity of 99% with an isolate of Helicotylenchus sp. labeled as CD761, with accession numbers KM506844 and KM506845. The sequences obtained in this study for individuals identified morphologically as H. erythrinae and H. californicus are proposed as standard and reference populations until topotype specimens become available and were molecularly characterized. All sequences obtained in the present study were deposited in NCBI with accession numbers MT321729-MT321739 (Table 7).
Information of sequences D2 to D3 of ribosomal DNA downloaded from GenBank and obtained in the present study for Helicotylenchus.
| Species name | Location | Plant-host | GenBank accession number | Reference or source |
|---|---|---|---|---|
| H. dihystera | Colombia, Córdoba, Quindío | Musa AAA (Banana) | MT321729; MT321730 | Present study |
| H. dihystera | USA, Florida, Ft Lauderdale | Schefflera arboricola | HM014245 | Subbotin et al. (2011) |
| H. dihystera | USA, Florida, Goulds | Bromeliads | HM014246 | Subbotin et al. (2011) |
| H. dihystera | USA, Florida, Ft Pierce | Ficus | HM014247 | Subbotin et al. (2011) |
| H. dihystera | USA, Hawaii, Kawai | Grasses | HM014248 | Subbotin et al. (2011) |
| H. dihystera | USA, Georgia | – | HM014249 | Subbotin et al. (2011) |
| H. dihystera | USA, Hawaii, Kawai | Grasses | HM014250 | Subbotin et al. (2011) |
| H. dihystera | USA, Georgia | – | HM014251 | Subbotin et al. (2011) |
| H. dihystera | USA, California, Kern county | Vitis vinifera | KM506834 | Subbotin et al. (2015) |
| H. dihystera | USA, Texas (plant shipment) | – | KM506835 | Subbotin et al. (2015) |
| H. dihystera | USA, California, Merced | Grasses | KM506836 | Subbotin et al. (2015) |
| H. dihystera | China, Fujian Province | Musa sp. | KF486503 | Xiao et al. (2014) |
| H. leiocephalus | USA, Nebraska, Lincoln, Nine mile Prairie | Amorpha canescens | HM014268; HM014269 | Subbotin et al. (2011) |
| H. pseudorobustus | USA, Kansas, Konza Prairie, Manhattan | Koeleria pyramidata | HM014266; HM014267 | Subbotin et al. (2011) |
| H. pseudorobustus | New Zealand, MAF farm, Kaitoke | Lolium perenne, Trifolium repens | HM014278 | Subbotin et al. (2011) |
| H. pseudorobustus | New Zealand, Rotorua | Lolium perenne | HM014279; HM014280 | Subbotin et al. (2011) |
| H. pseudorobustus | China, Beijing | – | DQ328747 | Subbotin et al. (2011) |
| H. pseudorobustus | USA, California, Fresno | – | DQ328748 | Subbotin et al. (2011) |
| H. pseudorobustus | Italy, Ancona | – | DQ328750 | Subbotin et al. (2011) |
| H. pseudorobustus | Germany, Münster, BBA glasshouse | – | DQ328751 | Subbotin et al. (2011) |
| Helicotylenchus spIV-2 | USA, Florida, Gainesville, Winter garden | Calathea sp. | KM506844 | Subbotin et al. (2015) |
| H. multicinctus | Colombia, Calarcá, Quindío | Musa AAA (Banana) | MT321731 | Present study |
| H. multicinctus | Colombia, Rozo, Palmira, Valle del Cauca | Musa AAB (Plantain) | MT321732; MT321733; MT321734 | Present study |
| H. multicinctus | South Africa, Lambani | Musa sp. | HM014290; HM014291 | Subbotin et al. (2011) |
| H. multicinctus | USA, Florida, Ft. Pierce | Ficus benjamina | HM014292 | Subbotin et al. (2011) |
| H. multicinctus | Sudan | Musa sp. | DQ328745; DQ328746 | Subbotin et al. (2011) |
| H. multicinctus | China, Fujian Province | Musa sp. | KF443214 | Xiao et al. (2014) |
| H. californicus | Colombia, La Delfina, Buenaventura, Valle del Cauca | Musa AAB (Plantain) | MT321735; MT321736; MT321737; MT321738 | Present study |
| H. erythrinae | Colombia, La Celia, Risaralda | Musa AAB (Plantain) | MT321739 | Present study |
| H. labiodiscinus | USA, Kansas, Manhattan | Poa pratensis | HM014293 | Subbotin et al. (2011) |
| H. labiodiscinus | USA, Kansas, Manhattan | Andropogon gerardii | HM014294 | Subbotin et al. (2011) |
| H. labiodiscinus | USA, Kansas, Manhattan | Schizachyrium scoparium | HM014295 | Subbotin et al. (2011) |
| H. martini | South Africa, Lambani | Grasses | HM014304; HM014305 | Subbotin et al. (2011) |
| H. brevis | South Africa, North West Province | Solanum mauritianum | HM014299; HM014300 | Subbotin et al. (2011) |
| H. vulgaris | Italy, Ancona | – | DQ328759; DQ328760; DQ328761 | Subbotin et al. (2011) |
| H. vulgaris | USA, Kansas, University of Arkansas | – | FJ485650 | Subbotin et al. (2011) |
Note: Information of new sequences obtained in the present study are marked in italic.
The evolutionary relationships of 51 sequences of the D2 to D3 expansion segment of ribosomal DNA for Helicotylenchus, including those obtained in the present study (Table 7), are depicted in Figures 5 and 6. The sequences of H. multicinctus obtained in this research clustered in the same clade with other sequences of this species, including some populations from Musa sp. plantations, such as DQ328745 and DQ328746 from Sudan, HM014290 and HM014291 from Lambani, South Africa, and KF443214 from Fujian, China. Monophyly of this species was recovered both with maximum likelihood (bootstrap support or BS = 96%) and Bayesian inference (posterior probability of PP = 1). Likewise, the sequences of H. dihystera from Colombia obtained in this research, grouped in the same clade with other sequences of that species, including HM014248 and HM014250 from grasses in Hawaii and KF486503 from Musa sp. in Fujian, China (BS = 95%, PP = 1). The sequence of H. erythrinae grouped with the clade of H. labiodiscinus, although the support for this group was weak (BS = 63%, PP = 0.75). Finally, the sequences of H. californicus formed a clade with a sequence of Helicotylenchus sp. isolate CD761 from Calathea in USA (KM506844) (BS = 98%, PP = 1). These results support the presence of four species of Helicotylenchus in the Musa crops that were sampled.
Figure 5:
Maximum likelihood phylogeny of Helicotylenchus. The tree was estimated using the D2 to D3 expansion segment of 28S RNAr and 250 bootstraps under GTR + Γ model. The outgroup (Rotylenchus magnus) is shown in gray font; the sequences that were obtained in this study appear in bold typeface. Values at the nodes represent the bootstrap support. Were provided bootstrap support for nodes with values > 80. The scale represents the number of substitutions per site.
Figure 6:
Bayesian phylogeny of Helicotylenchus based on D2 to D3 expansion segment of 28S RNAr. The phylogeny is a consensus tree from a posterior distribution of 1,600 trees that were inferred under GTR + Γ model in MrBayes. The outgroup (Rotylenchus magnus) is shown in gray font; the sequences that were obtained in this study appear in bold typeface. Values at the nodes represent the posterior probability. Were provided posterior probabilities for nodes with values > 0.5. The scale represents the number of substitutions per site.
A total of 10 Helicotylenchus populations associated with Musa spp. crops were identified to the species level in the present study: four H. multicinctus, two H. dihystera, two H. californicus, and two H. erythrinae. All species identified in this study occur in Colombia, while only two species were registered in Brazil (H. multicinctus and H. californicus). Morphometric measurements recorded for these species closely resemble the type and reference populations (Golden, 1956; Sher, 1961; Van Den Berg and Heyns, 1975; Krall, 1990; Mizukubo et al., 1992; Wount and Yeates, 1994; Uzma et al., 2015).
Although it is reported that morphological and morphometric identification of species in Helicotylenchus is a difficult task because many species share very similar diagnostic characters and overlapping morphometrics, the populations of Helicotylenchus studied associated with Musa spp. were satisfactorily identified to the species level through morphological and morphometric evidence. PCA and conglomerate analysis clearly separated the four species identified, confirming the utility of morphological and morphometric data but also of multivariate statistical analysis to discriminate among species of the genus (Fortuner and Maggenti, 1991; Subbotin et al., 2015; Uzma et al., 2015). In accordance with PCA, the variables associated with the tail are diagnostic characters powerful enough to discriminate between or to separate among H. multicinctus, H. dihystera, H. californicus, and H. erythrinae, which could be useful for preparing a dichotomous key for identification of Helicotylenchus species in Colombia (Mizukubo et al., 1992; Uzma et al., 2015).
The diagnostic characters: number of tail annuli, ratio c′, maximum body diameter, tail length, anal body diameter, and vulva position separated the species identified in this study in accordance with PCA and conglomerate analysis. In various publications, tail length and DGO have been suggested by their discriminate values among Helicotylenchus species (Perry et al., 1959; Fortuner et al., 1984). Additionally, intraspecific variability at the morphometric level was observed in the four species identified in this study, due to the various morphological and morphometric unconstant characters with a coefficient of high variability within of Helicotylenchus species (Fortuner et al., 1981; Fortuner, 1984).
Different morphological and morphometric characters were constants within the species identified, as habitus, ratio a and V as reported for various species of Helicotylenchus (Fortuner, 1984). Variation in the shape of the tail was registered in females of the Colombian population of H. californicus. This species is characterized by showing individuals with short ventral projections and sharply pointed or blunt tails (Van Den Berg and Heyns, 1975; Krall, 1990). Variability in the shape of the tail to the intraspecific level has been recorded for various species of Helicotylenchus (Fortuner, 1979).
Molecular analysis supported the presence of H. multicinctus, H. dihystera, H. californicus, and H. erythrinae in Musa spp. crops from Colombia. Interestingly, in the phylogenetic tree, Colombian sequences of H. multicinctus and H. dihystera clustered in the same clade with sequences of nematodes isolated from banana crops in Africa and China, respectively (Subbotin et al., 2011; Xiao et al., 2014). The sequences obtained for H. californicus grouped with an isolate of Helicotylenchus from Calathea not identified to the species level and labeled as CD761 in Subbotin et al. (2015) (Table 7). Recently, Fortuner et al. (2018) identified isolate CD761 as H. pseudorobustus using morphological and morphometric analysis. However, our populations are similar to preliminary reports of H. californicus (Van Den Berg and Heyns, 1975; Krall, 1990). Unfortunately, there are no sequences of reference for H. erythrinae deposited in any of the databases of genes in the world for comparison. Therefore, the present study is reporting the first sequences of H. californicus and H. erythrinae associated to Musa spp. in a public database.
The four species identified in this study, H. multicinctus, H. dihystera, H. californicus, and H. erythrinae, have been reported in Musa spp. crops around the world (Campos et al., 1987; Araya and De Waele, 2004; Karakas, 2007; Dias-Arieira, 2010; Ravichandra, 2014; Xiao et al., 2014; Lara et al., 2016; Tzortzakakis et al., 2017). However, this is the first report of these species for Musaceae crops in Colombia through integrative taxonomy. Additionally, this research confirmed that Helicotylenchus species occur individually or in a mixture in Musaceae crops in the studied zones, which has been documented in the past in other production zones of the world (Araya and De Waele, 2004; Dias-Arieira, 2010; Roy et al., 2014; Khan and Hasan, 2010; Ravichandra, 2014; Daneel et al., 2015).
In relation to H. multicinctus, it is considered the most limiting species of Helicotylenchus in plantain and banana. It was present in the Musa crop production of both Colombia and Brazil, confirming the wide distribution of this plant-parasitic nematode, which also has been previously registered in Puerto Rico, Vietnam, India, Mexico, and Greece (Ngoc Chau et al., 1997; Ravichandra, 2014; Lara et al., 2016; Tzortzakakis et al., 2017). The presence of H. multicinctus in the different production zones, Quindío and Valle del Cauca, suggests a wide spread of this nematode in Colombia, directly related with the dispersion of contaminated seedlings between production zones, but also to environmental conditions that have favored the establishment of this species (altitude, soil type, and nutrient availability for the plant) (Nath et al., 1998; Speijer and Ssango, 1999; Araya et al., 2011; Godefroid et al., 2017).