Table A1.
List of stably expressed genes in M. hapla based on RNAseq database.
| M. hapla gene ID | Annotation |
|---|---|
| MhA1_Contig20.frz3.gene50 | Intramembane protease 2 |
| MhA1_Contig609.frz3.gene1 | Not annotated |
| MhA1_Contig627.frz3.gene3 | Fructose-bisphosphate aldolase 2 |
| MhA1_Contig649.frz3.gene8 | Myosin regulatory light chain 2 |
| MhA1_Contig675.frz3.gene6 | Probable arginine kinase |
| MhA1_Contig684.frz3.gene7 | Probable splicing factor, arginine/serine-rich 5 |
| MhA1_Contig91.frz3.gene33 | elongation factor 1-alpha |
| MhA1_Contig95.frz3.gene17 | elongation factor 1-alpha |
| MhA1_Contig96.frz3.gene30 | Troponin 1 |
| MhA1_Contig113.frz3.gene12 | A-kinase anchor protein 1, mitochondrial |
| MhA1_Contig113.frz3.gene45 | Heat shock 70 kDa protein |
| MhA1_Contig1167.frz3.gene2 | KIN-4 protein |
| MhA1_Contig130.frz3.gene58 | not annotated |
| MhA1_Contig131.frz3.gene10 | 40 S ribosomal protein S6 |
| MhA1_Contig1354.frz3.gene2 | not annotated |
| MhA1_Contig163.frz3.gene44 | not annotated |
| MhA1_Contig1687.frz3.gene1 | not annotated |
| MhA1_Contig1972.frz3.gene3 | Heat shock protein 90 |
| MhA1_Contig2015.frz3.gene6 | Bax inhibitor 1 |
| MhA1_Contig2458.frz3.gene1 | not annotated |
| MhA1_Contig253.frz3.gene11 | not annotated |
| MhA1_Contig253.frz3.gene39 | not annotated |
| MhA1_Contig256.frz3.gene21 | Vinculin |
| MhA1_Contig261.frz3.fgene1 | Dynein heavy chain, cytoplasmic |
| MhA1_Contig342.frz3.gene52 | Activating signal cointegrator 1 complex subunit 3 |
| MhA1_Contig349.frz3.gene33 | spliceosime RNA helicae DDX39B homolog |
| MhA1_Contig400.frz3.gene18 | FACT complex subunit SSRP1 |
| MhA1_Contig800.frz3.gene34 | Calsyntenin-1 |
| MhA1_Contig1000.frz3.gene28 | 60 S ribosomal protwin L3 |
| MhA1_Contig1372.frz3.fgene1 | Glutathione S-transferase P |
| MhA1_Contig2493.frz3.fgene1 | Not annotated |
Table 1.
Root sampling time points.
| First week | Three weeks dpia |
|---|---|
| 1 dpi | Light |
| 2 dpi | 05:30 |
| 4 dpi | 13:00 |
| 5 dpi | 20:00 |
| 7 dpi | Dark |
| 21:30 | |
| 23:00 | |
| 04:00 |
Table 2.
Validated Candidate housekeeping genes and primers for M. incognita.
| Gene symbol | Forward | Reverse | M. hapla gene ID | M. incognita homologue loci | Annotation |
|---|---|---|---|---|---|
| Actin1 | GGGTATGGAATCTGCTGGTATT | CATGGTCGTACCTCCAGAAAG | MhA1_Contig4.frz3.gene2 | Minc3s00730g16611 Minc3s00960g19311 | Actin |
| Disu | CACCGCTAATGAAGTTGAAGATG | CGCTCTCCAGTGTAGTCAATAA | MhA1_Contig165.frz3.gene9 | Minc3s01268g22290 Minc3s02350g29607 Minc3s04154g35616 | protein disulfide-isomerase |
| Minc04440 | GCCGCCATCTTGGCTATTA | GGTGGGACCAAATCCTTGTAT | MhA1_Contig113.frz3.gene11 | Minc3s00096g04440 Minc3s00113g04971 Minc3s00259g08816 | not annotated |
| Poly | ACGTCCAGAGAATCTGACAAAC | CCACGGCAATAGCGAGATAC | MhA1_Contig123.frz3.gene87 | Minc3s01682g25559 Minc3s03281g33396 | Polyadenylate-binding protein |
| ELF | CTCCTGGACACGTTGACTTC | GCACACAAACTCCTGAAACAC | MhA1_Contig256.frz3.fgene4 | Minc3s00468g12850 Minc3s00594g14836 Minc3s01848g26725 Minc3s02628g30935 | Elongation factor 2 |
| PTP | GGAAAGCATTTTCACCTGCGA | ACGGGTTGCCAACAGATGAA | MhA1_Contig342.frz3.gene42 | Minc3s00073g03598 Minc3s00981g19546 Minc3s03830g34926 | protein transport |
| Skinase | AGCGTTTGGTTGCTCTCTCA | GACTCTCCCACGCAAGGAAT | MhA1_Contig647.frz3.gene12 | Minc3s00176g06827 Minc3s00279g09289 Minc3s03755g34706 Minc3s09595g43359 Minc3s11722g45107 | Serine/threonine-protein kinase smg-1 |
Table A2.
Primers and annotation for differently expressed genes.
| Gene name | Forward | Reverse | M. hapla gene ID | M. incognita gene ID | Annotation |
|---|---|---|---|---|---|
| Colla | CCAATCTCTCTACAGGCAGAAAC | GGACCAGGTGCGCAATTA | MhA1_Contig1040.frz3.gene14 | Minc3s00036g02116 Minc3s00100g04559 | nematode cuticle collagen |
| NHL | GTCCCCACAGGCACTTTCTT | GCCGACGAGGAAGTGTTCTT | MhA1_Contig7.frz3.gene17 | Minc3s00018g01178 Minc3s00027g01714 | NHL repeat |
| Actin2 | GATGGCTACAGCTGCTTCGT | GGACAGTGTTGGCGTAAAGG |
Figure 1:
Candidate housekeeping gene selection pipeline.
Figure 2:
Summary of KEGG annotation of the candidate housekeeping genes.
Figure 3:
Stability value of validated housekeeping genes across life cycle of M. incognita calculated by geNorm. Juvenile stage samples were collected within the first week, adult stage samples were collected 3 wk after inoculation, and all stages samples include previous stages, eggs and uninfected juveniles. Orange bars are negative control which were differently expressed genes (Colla: DEG = 10; NHL: DEG = 1), and blue bars are candidate housekeeping genes. Genes with stability value below 0.15 are considered suitable reference genes.
Figure 4:
Stability value of validated housekeeping genes across life cycle of M. incognita calculated by NormFinder. Juvenile stage samples were collected within the first week, adult stage samples were collected 3 wk after inoculation, and all stages samples include previous stages, eggs and uninfected juveniles. Orange bars are negative control which were differently expressed genes (Colla: DEG = 10; NHL: DEG = 1), and blue bars are candidate housekeeping genes. Genes with stability value below 0.08 are considered suitable reference genes for this study.