Skip to main content
Have a personal or library account? Click to login
First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco Cover

First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco

Open Access
|May 2019

Full Article

Nematodes of the genus Xiphinema are ectoparasites that feed on extensive range of hosts. Some species of this genus are economically important pests of agricultural plants and others are vectors of Nepovirus. In April 2018, during a survey, specimens of dagger nematode (Xiphinema spp.) were collected from soil around the rhizosphere of onion (Allium cepa L.) with poor growth appearance and low yield from Ouled Dahou, Souss-Massa region of Morocco (Fig. 1). Nematodes were extracted from soil using a modified Baermann technique (Hooper, 1990). On an average, nine nematodes per 100 cm3 soil were obtained. The collected nematodes were subjected to morphological and molecular characterization. All specimens were identified as Xiphinema pachtaicum based on the alpha-numeric polytomous identification key codes developed by Lamberti et al. (2002). The females had a body forming a close C after fixation. Lip region was distinctly offset by constriction. Odontostyle was robust and odontophore had weak flanges. Morphometric measurements of Xiphinema pachtaicum are listed in Table 1. The morphometric data of described Moroccan specimens were perfectly fit within the two populations of Xiphinema pachtaicum recorded by Orlando et al. (2016) from Italy.

Table 1.

Morphometric measurements of Xiphinema pachtaichum.

Character Xiphinema pachtaicum (Females)
n 10
L1,822 ± 40.5 (1770–1891)
a63 ± 2.4 (59–65)
b6.3 ± 0.2 (5.9–6.7)
c62 ± 4.6 (54–67)
c’1.7 ± 0.2 (1.4–2)
V53.8 ± 3 (49–58)
Lip region width8.7 ± 0.4 (8.1–9.3)
Odontostyle83 ± 3.5 (78–88)
Odontophore49 ± 4.7 (44–57)
Pharynx289 ± 12.5 (270–315)
Body width28.9 ± 0.8 (28–30)
Anal body width17.2 ± 1.2 (16–19)
Tail length29.4 ± 2.1 (28–34)
Anterior end to vulva979 ± 53 (891–1051)

Note: All measurements are in ?m, measurements presented as mean ± standard deviation (range).

Figure 1:

Xiphinema pachtaicum damage symptoms on onion plants include stunting of plants and yellowing of leaves.

To confirm the identity of X. pachtaicum, DNA was extracted from single females (n = 2) by using the protocol described by Holterman et al. (2006). Two primers were used: forward D2a (5′ ACAAGTACCGTGAGGGAAAGTTG 3′) and reverse D3b (5′ TGCGAAGGAACCAGCTACTA 3′) for the amplification of the D2D3 region of 28S rRNA (Nunn, 1992). The PCR products (represented by accession Nos. MK622911 and MK622912) were sequenced, aligned and compared with published sequences by means of BLAST search in the database. The comparison revealed 99 to 100% similarity, with sequence corresponding to X. pachtaicum and 97% or less sequence similarity with other Xiphinema spp. To our knowledge, this is the first report of X. pachtaicum parasitizing onion in Morocco.

DOI: https://doi.org/10.21307/jofnem-2019-028 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 1 - 2
Submitted on: Mar 18, 2019
Published on: May 27, 2019
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2019 Fouad Mokrini, Abdelfattah Dababat, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.