IRAK inhibitor can improve insulin sensitivity in insulin-resistant mice fed with a high-fat diet Cover

.blurhash-client-img { display: none !important; }

IRAK inhibitor can improve insulin sensitivity in insulin-resistant mice fed with a high-fat diet

Asian Biomedicine

Volume 14 (2020): Issue 6 (December 2020)

By: Mostafa Allahyari , Athena Rajaie and Hossein Fallah

Open Access

|Dec 2020

Figures & Tables

Timeline of treatment of the mice. Mice were treated with their respective diets for 14 weeks. They were treated with the interventional drugs or controls for the final 2 weeks ahead of final measurements.

(A) Weight of the mice at the beginning (light gray) and the end (dark gray) of the study. The mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Control mice received no treatment. (B) Weight gain (n = 8 mice in each group). ***P < 0.0001 compared with the control group (high-fat diet). ###P < 0.0001 compared with the sham group (high-fat diet, DMSO vehicle control treatment). *P < 0.05 compared with the standard diet group.

Serum levels of biochemical factors. Insulin resistance was developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Glucose, triglyceride, and cholesterol were measured in serum of mice after 12 h fasting. **P < 0.001, ***P < 0.0001 compared with the control group. ##P < 0.001, ###P < 0.0001 compared with the sham group, ††P < 0.001 compared with the standard diet group (n = 8 mice per group).

Serum levels of insulin in fasting mice. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Blood serum insulin was then measured after 12 h fasting. **P < 0.001 compared with the control group, ##P < 0.001 compared with the sham group (n = 8 mice per group).

HOMA-IR index in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). HOMA-IR was computed using a standard formula. ***P < 0.0001 compared with the control group. ###P < 0.0001 compared with the sham group. †P < 0.05 compared with the standard diet group (n = 8 mice per group).

IL-6 mRNA copy numbers in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). qPCR assayed the level of IL-6 gene expression. *P < 0.05, **P < 0.01, ***P < 0.0001 compared with the control group. #P < 0.05, ##P < 0.001, ###P < 0.0001 compared with the sham group. ††P < 0.001 compared with the standard diet group. ‡‡P < 0.001 comparing IRAKi and IRAKi/Pio groups (n = 8 mice per group).

Primer sequences for qPCR

Direction	GAPDH	IL-6
Forward primer (5′–3′)	CCCATCACCATCTTCCAGGAGC	CCTCTGGTCTTCTGGAGTACC
Reverse primer (5′–3′)	CCAGTGAGCTTCCCGTTCAGC	ACTCCTTCTGTGACTCCAGC

DOI: https://doi.org/10.1515/abm-2020-0034 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415

Journal RSS Feed

Language: English

Page range: 253 - 260

Published on: Dec 31, 2020

Published by: Chulalongkorn University

In partnership with: Paradigm Publishing Services

Publication frequency: 6 issues per year

Keywords:

adipose tissue,

diabetes mellitus,

insulin resistance,

thiazolidinediones

Related subjects:

Assistive professions, nursing,

Basic medical science,

Basic medical science, other,

Clinical medicine,

Clinical medicine, other

© 2020 Mostafa Allahyari, Athena Rajaie, Hossein Fallah, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous article Volume 14 (2020): Issue 6 (December 2020)Next article