Skip to main content
Have a personal or library account? Click to login
Development of a point-of-care test to detect hepatitis B virus DNA threshold relevant for treatment indication Cover

Development of a point-of-care test to detect hepatitis B virus DNA threshold relevant for treatment indication

Open Access
|Oct 2019

Full Article

Hepatitis B virus (HBV) is the most prevalent blood-borne pathogen infecting approximately 250 million people [1], and could potentially establish a chronic infection leading to life-threatening cirrhosis and hepatocellular carcinoma. The virus belongs to a family Hepadnaviridae and its 3.2 kb partially double-stranded genome is packed into an enveloped, spherical virion. According to the World Health Organization (WHO), a combination of HBV vaccine and immunoglobulin elicits 80%–95% protective effect to prevent mother to child transmissions when administrating within 24 h after childbirth. Still, 1%–9% of newborns were infected in utero from mother whose status were chronic HBV infection [2]. Moreover, the vaccination still limited its coverage in certain countries [3] resulting in increasing vulnerable population. Accumulated evidences suggested that treating expectant mothers with significant viremia (≥2 × 105 IU/mL, or ≥102 copies/reaction) in third trimester would prevent mother to child transmission more efficiently (reviewed by Jaffe and Brown [4]). The first-line chemotherapy was tenofovir administered from 30–32 weeks gestation to a month after delivery [5]. Following this guideline, an HBV genome detection should be included in the national program for antenatal screening in order to identify this group of high-risk pregnancy. The test was also expected to be accurate to meet the standard quantitative polymerase chain reaction (qPCR) system [6], as well as simple and cost-effective applicable in rural areas. The alternative viral load assessment method is required because of limited availability to the qPCR machine and its operating system.

The major requirements of the newly developed antenatal HBV screening would be the ability to sort out significantly viremic samples with accuracy, rapidity, feasibility, and cost-effectiveness. Turbidity-based loop-mediated isothermal amplification (LAMP) could potentially serve these specific needs [7]. LAMP utilizes a Bst polymerase for target amplification under a constant single temperature with a 30- to 60-min incubation [8]. The amplified product can be detected by various methods [9], but turbidity detection is the most promising means to be optimized toward both arms of accuracy and cost-effectiveness [10]. Although several HBV LAMP protocols have been described, limitations were still noted whenever applying to point of care. For example, the detection system in previous developments required a qPCR machine [11, 12] that was unavailable in the resource-limited area. Also, it is our aim to deliberately avoid chromogenic or fluorogenic substrates addition in order to minimize the cost per reaction. A recently developed in-house turbidimeter [7] can directly detect the rate of reaction by measuring magnesium pyrophosphate by-product in real time with economical price. Turbidity-based detection was generally applied to the diagnosis of various pathogens such as Plasmodium spp [13], Haemophilus influenzae type b [14], and Listeria ivanovii [15]. In addition to LAMP, DNA extraction method can also be simplified to heat treatment with equal sensitivity to conventional silica-based extraction method [16]. In this study, we aimed to develop a reliable, simplified, and budget-friendly turbidity-based HBV LAMP for a routine antenatal screening.

Materials and methods
Primer design and evaluation

The whole genome of HBV, strain ayw (NC_003977) [17] was used as a template for primer design (Primer Explorer 4.0, Eiken Chemical CO., LTD., Japan). Three sets of LAMP primers (S1, S2, and X) (Table 1) were selected based on the following conditions: (1) the primer length of 18–25 base pairs, (2) the melting temperature of 60–65°C, and (3) the estimated Gibbs free energy of below −4 kJ/mol. Sequences were checked for self-priming and specificity before synthesis (Integrated DNA Technologies, USA). Each primer set was evaluated for amplification efficiency using a standard 2% agarose electrophoresis.

Table 1

Oligonucleotide sequences of three newly designed and one previously reported primer sets

Primer setPrimer nameLocationPrimer sequence (5‘ à 3‘)Genetic region
S1S1_F3470–491CCGTTTGTCCTCTAATTCCAGGS and P gene
S1_B3665–688GCACTAGTAAACTGAGCCAGGAGA
S1_FIP541–564GGAGGGATACATAGAGGTTCCTTG-TTTT-CCTCAACAACCAGCACGGGA
494–513
S1_BIP571–592TGTACCAAACCTTCGGACGGAA-TTTT-CCCACTCCCATAGGAATTTTCC
631–652
S1_LF520–540AGCAGTAGTCATGCAGGTCCG
S1_LB595–616TGCACCTGTATTCCCATCCCAT
S2S2_F3659–678CTGCATGACTACTGCTCAAGGAS and P gene
S2_B3712–731AGCCAAACAGTGGGGGAAAG
S2_FIP595–615TGGGATGGGAATACAGGTGCA-TTTT-CCTCTATGTATCCCTCCTGTTGCT
548–571
S2_BIP631–651GGAAAATTCCTATGGGAGTGGG-TTTT-CCCTACGAACCACTGAACAAATGG
688–711
S2_LF572–591TCCGTCCGAAGGTTTGGTAC
S2_LB659–678CCCGTTTCTCCTGGCTCAGT
XX_F31493–1512CCTTCTCCGTCTGCCGTTCCX gene
X_B31728–1747CCCCAACTCCTCCCAGTCTT
X_FIP1577–1596GTGAAGCGAAGTGCACACGG-TTTT-CACCTCTCTTTACGCGGACTCC
1529–1540
X_BIP1627–1646CGCCCACCAAATATTGCCAA-TTTT-TATGCCTCAAGGTCGGTCGTTG
1686–1707
X_LF1559–1576TCCGGCAGATGAGAAGGC
X_LB1662–1685GGACTCTTGGACTCTCAGCAATGT
Nyan et al. [19]Ref_F3530–249TCCTCACAATACCGCAGAGTS and P gene
Ref_B3402–421GCAGCAGGATGAAGAGGAAT
Ref_FIP305–326GTTGGGGACTGCGAATTTTGGC-TTTT-TAGACTCGTGGTGGACTTCT
251–270
Ref_BIP333–354TCACTCACCAACCTCCTGTCCT-TTTT-AAAACGCCGCAGACACAT
379–396
Ref_LF271–294GGTGATCCCCCTAGAAAATTGAG
Ref_LB357–378AATTTGTCCTGGTTATCGCTGG

F3, outer forward primer; B3, outer backward primer; FIP, forward inner primer; BIP, backward inner primer; LF, loop forward primer; LB, loop backward primer.

Standard HBV DNA preparation

The plasmid pUC19 containing a whole HBV genome AB246345 [18] was propagated in MAX Efficiency® DH5α™ competent cells (Thermo Fisher Scientific, USA). The plasmid was extracted and purified using a High-Speed Plasmid Mini Kit (Geneaid Biotech Ltd., Taiwan) and the concentration was measured using a NanoDrop 1000 (Thermo Scientific, USA). The plasmid was adjusted to the concentration of 1 mg/mL and stored as aliquots at −20°C until use.

LAMP reaction and turbidity detection

A HBV LAMP reaction consisted of 2.5 mL of 10× isothermal amplification buffer (New England Biolabs, USA), 150 mM MgSO4, 0.14 mM dNTPs, 5 mM of F3 and B3 primers, 40 mM of forward inner primer (FIP) and backward inner primer (BIP) primers, 10 mM of loop forward primer (LF) and loop backward primer (LB) primers, eight units of Bst 2.0 Polymerase (New England Biolabs, USA), 2 mL of DNA sample, and deionized distilled water to a final volume of 25 mL. The reaction was incubated at 60°C for 60 min before inactivating the enzyme at 95°C for 2 min. Turbidity was detected using 8-well turbidimeter (Mobilis Automata co., Ltd., Thailand) [7] and the results were analyzed using an LAMP-Turbidity plotter version 1.0 (National electronics and computer technology center, NECTEC, Thailand).

Sensitivity test

Assay sensitivity was tested from serially diluted standard HBV DNA to the final concentrations of 107, 106, 105, 104, 103, 102, and 10 copies and performed under optimized condition as described above. The reactions were incubated in turbidimeter at 60°C for 60 min and correlation between turbidity detection and HBV genome concentration was analyzed. In the spiked serum experiment, the standard HBV DNA at 108 to 102 copies was spiked into fetal bovine serum (1:100 v/v). Samples were diluted with equal amount of deionized distilled water and incubated at 95°C for 5 min and 100°C for 3 min before proceeding to turbidity-based HBV LAMP. Results were confirmed by four independent experiments.

Specificity test

The specificity of the HBV–LAMP assay was tested under optimized condition with six viral DNAs provided as positive controls as follows: HBV (Abbott, USA), human immunodeficiency virus (HIV) (Abbott, USA), Epstein–Barr virus (EBV, cytomegalovirus (CMV), hepatitis C virus (HCV), and herpes simplex virus (HSV) (Qiagen, Germany). The LAMP products were detected using agarose gel electrophoresis. All standard viral DNAs were kindly gifted from King Chulalongkorn Memorial Hospital and were added at 2 × 105 copies to the reaction.

Analysis of clinical samples

All plasma samples and their automated qPCR results (Abbott, USA) were courtesy of Virology unit, King Chulalongkorn Memorial Hospital with IRB approval (certificate of approval no. 972/2016) from Ethical Review Board, Faculty of Medicine, Chulalongkorn University. The samples were leftovers from routine diagnosis and stored at −70°C. The frozen plasma was rapidly thawed at 37°C and the DNA was extracted from the samples using the heat treatment method [19]. Briefly, the sample was diluted with equal amount of deionized distilled water, followed by incubation at 95°C for 5 min and 100°C for 3 min. DNA was collected from supernatant after centrifugation at 12,000 g for 5 min. Turbidity-based HBV LAMP assay was performed and analyzed as previously indicated. The LAMP product was also analyzed by gel electrophoresis to confirm the end-point results. Results from turbidimeter and gel electrophoresis were compared with those of qPCR diagnostic records.

Results
Primers and reagent optimization

Three sets of primers (S1, S2, and X) were generated according to the parameters described in Materials and methods section. Efficacy of primer sets was verified using the standard HBV DNA (Figure 1A). Results showed that S2 and X, but not S1, primer sets expressed positive amplification bands in ladder-like pattern, similar to previous report [19]. Next, we optimized the assay condition by varying 4 parameters as follows: temperature (55°C, 60°C, 63°C, and 65°C), betaine (0 M, 0.2 M, 0.4 M, and 0.8 M), dNTPs (1.2 mM, 1.4 mM, 1.6 mM), and MgSO4 (4 mM, 6 mM, 8 mM). Each assay condition was analyzed using 10-fold serially diluted HBV plasmid (102–105 copies). Results indicated that the optimal condition for S2 primer set was at 60°C with no betaine, 1.4 mM dNTPs, and 6 mM of MgSO4 demonstrating the detection at 100 copies/reaction in the reaction using 2% agarose gel electrophoresis (Figure 1B and Table 2). Moreover, we verified the HBV DNA template as a standard positive control for further experiments by amplification with established universal primers [20]. PCR results showed that the HBV template was successfully detected by universal primers (Figure 1C); therefore, we reinstated that the plasmid containing HBV genome used in this assay development was a standard HBV DNA template.

Table 2

Sensitivity of turbidity- and gel electrophoresis-based HBV LAMP detection system

HBV DNA (copies/ reaction)Percent detection (No. of times detected/total replicated)
Turbidity basedGel electrophoresis based
2000100 (6/6)100 (3/3)
1000100 (6/6)100 (3/3)
20083 (5/6)100 (3/3)
15083 (5/6)100 (3/3)
100100 (9/9)100 (3/3)
5050 (3/6)67 (2/3)
2067 (4/6)67 (2/3)
1033 (1/3)
533 (1/3)
2.567 (2/3)
133 (1/3)
0.50 (0/3)
0.133 (1/3)

HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification.

Sensitivity of turbidity-based HBV–LAMP assay

The turbidity-based LAMP was set up using the optimal condition for S2 primer set as described and the turbidity was detected using hot plate-coupled, real-time turbidimeter [7]. This turbidimeter detected magnesium pyrophosphate by-product from the LAMP assay in real time. We compared sensitivity of both detection systems using serially diluted standard HBV DNA (Table 1) and results showed equal limit of detection (LoD) at 102 copies/reaction. Moreover, the time to turbidity threshold at the lowest and highest concentrations (102 and 108 copies) was 1888.75 ± 84.94 s, and 1365.75 ± 94.68 s, respectively, suggesting that the positive results should be detected by this assay during 22.76 ± 1.58 and 31.48 ± 1.41 min. Also, a nonlinear correlation of HBV DNA and the threshold of time to positive turbidity were observed (Figure 2A) suggesting that this real-time HBV LAMP turbidity could be applicable in semiquantitative format. In addition to turbidimeter, the positive results can be detected from direct visualization and distinguishable from the no template control (NTC) (Figure 2B). In addition, results can also be reported in using direct visualization for turbidity at the reaction end point. This option is applicable to resource-limited area where only heat block and centrifuge were available.

Figure 1

Figure 1 HBV LAMP primer tests (A) Three newly designed HBV LAMP primer sets (S1, S2, and X) and a previous report [19] were tested with standard HBV DNA (108 copies/reaction) and deionized distilled water as positive and negative controls. (B) S2 primer set was tested with serially diluted standard HBV DNA (102–108 copies/reaction). M and NTC were abbreviated from marker and no template control, respectively. (C) Sensitivity results from polymerase chain reaction using universal primers.

Figure 2

Turbidity-based HBV LAMP sensitivity test S2 primer set was tested with serially diluted standard HBV DNA (102–108 copies/reaction) in (A) turbidimeter and (B) direct visualization at the end point of the reaction.

Next, we tested the assay performance under the condition mimicking the actual serum samples in order to verify whether sera-derived proteins would interfere with the turbidity readout. Briefly, standard HBV DNA was serially diluted and spiked into fetal bovine serum (1:100 v/v), diluted 1:1 with deionized distilled water and heat treated before proceeding to turbidity-based HBV LAMP. The objective was to study possible turbidity interference from other contents in the serum when processing samples with heat treatment method. Our results were in accordance with the previous report comparing the heat treatment and standard DNA extraction methods [16]. LoD of this experiment was read at 102 copies/reaction with no significant difference from that of the sensitivity test previously described (P = 0.6571, Mann–Whitney test). In addition, the conventional HBV PCR amplified by universal primers (Figure 1C) was successfully detected the template at 103 copies per reaction. We concluded that the heat treatment method coupled with turbidity-based LAMP analysis was adequate for analysis of clinical samples.

Specificity test

The HBV LAMP was tested with the standard DNA of HBV, HIV, HCV, CMV, EBV, and Herpes viruses standardized to 2 × 105 copies/reaction as described in Materials and methods section. The assay was performed in turbidimeter for 60 min and the products were analyzed by gel electrophoresis. Positive results, or a ladder-like pattern, were found only in the HBV sample (Figure 3) suggesting that the HBV LAMP assay was exclusively specific to HBV.

Figure 3

Specificity test S2 primer set was tested with 2 × 105 copies of standard DNAs of hepatitis B virus (HBV), human immunodeficiency virus (HIV), Epstein–Barr virus (EBV), cytomegalovirus (CMV), hepatitis C virus (HCV), and herpes simplex virus (HSV) and analyzed by 2% agarose gel electrophoresis.

Evaluation with clinical samples

A total of 270 clinical samples consisted of 162 significant (<2 × 105 IU/mL) and 108 nonsignificant (<2 × 105 IU/mL) viremia according to the automated qPCR results. Samples were thawed and DNA was extracted using heat treatment method. HBV LAMP was performed in real-time turbidimeter and results were obtained using turbidity measurement (A650) and gel electrophoresis. The results were analyzed using 2 × 2 table for an accuracy of a diagnostic test [21] and compared with the diagnostic results from automated qPCR system. The turbidity-based LAMP method was sensitive, specific, and accurate at 90.12%, 83.33%, and 87.40%, respectively (Table 3), whereas results from the gel electrophoresis showed sensitivity, specificity, and accuracy of the test at 95.06%, 75.00%, and 87.03%, respectively. Interestingly, gel electrophoresis detection was more sensitive but less specific comparing to turbidity detection; in other words, the gel electrophoresis increased both detection rate and false-positive results. We concluded that the turbidity-based LAMP assay is applicable to discriminate the samples containing high viral titers (≥2 × 105 IU/mL) from those of low viral titers (<2 × 105 IU/mL) and negative results (undetectable) previously determined by qPCR (Abbott, USA). Moreover, the sensitivities, specificities, and accuracies of the tests were calculated using the other cutoff values (Table 4). Results showed that the test elicited the maximal accuracy at 105 IU/mL.

Table 3

Performance of turbidity-, and gel electrophoresis-based HBV LAMP assay at the 2 × 105 IU/mL cutoff titer of HBV qPCR results

MethodsSensitivity (%)Specificity (%)Positive predictive value (%)Negative predictive value (%)Accuracy (%)
Turbidity-based90.12 (146/162)83.33 (90/108)89.02 (146/164)84.90 (90/106)87.40 (236/270)
Gel electrophoresis95.06 (154/162)75.00 (81/108)85.08 (154/181)91.01 (81/89)87.03 (235/270)

HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification; qPCR, quantitative PCR.

Table 4

Performance of turbidity-, and gel electrophoresis-based HBV LAMP assay at other cutoff titers of HBV qPCR results

CutoffSensitivitySpecificityPPVNPVAccuracy
Turbidity
106131/13994.2%74/10570.5%131/16280.9%74/8290.2%84.0%
5 × 105140/15292.1%70/9276.1%140/16286.4%70/8285.4%86.1%
105146/16290.1%66/8280.5%146/16290.1%66/8280.5%86.9%
5 × 104150/17088.2%62/7283.8%150/16292.6%62/8275.6%86.9%
104156/18584.3%53/5989.8%156/16296.3%53/8264.6%85.7%
103157/20277.7%37/4288.1%157/16296.9%37/8245.1%79.5%
Gel electrophoresis
106135/13997.1%63/10560.0%135/17776.3%63/6794.0%81.1%
5 × 105147/15296.7%62/9267.4%147/17783.1%62/6792.5%85.7%
105154/16295.1%59/8272.0%154/17787.0%59/6788.1%87.3%
5 × 104157/17092.4%54/6773.0%157/17788.7%54/6780.6%86.5%
104163/18588.1%45/5976.3%163/17792.1%45/6767.2%85.2%
103168/20283.2%33/4278.6%168/17794.9%33/6749.3%82.4%

HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification; qPCR, quantitative PCR; PPV, positive predictive values; NPV, negative predictive values.

In addition, significant viremic samples were further analyzed for correlation with time to turbidity thresholds derived from turbidity-based LAMP assay [12]. Unfortunately, linear regression pattern was not found; therefore, we concluded that the time to turbidity threshold could not be used to quantify HBV viral load in turbidity-based LAMP assay.

Cost and method comparison

The major cost difference between qPCR and LAMP was the equipment used in each method. A quantitative thermal cycler machine price ranges between 30,000 and 50,000 USD, whereas a turbidimeter price used in this optimization was at 2,000 USD. In our design, we expected the local facilities to use a heat block (200–1200 USD), or a waterbath (50–100 USD). Since LAMP relied on an equipment capable of maintaining a single temperature for 30–60 min, the more economical choices of equipment selection can be considered. Moreover, the heat treatment method was not only feasible and time-saving, but also economical for omitting the DNA extraction process. Currently, DNA extraction kit price ranges between 2 and 5 USD/sample and requires about 2 h processing time. Cost and method comparison were summarized in Table 5.

Table 5

Cost comparison between quantitative PCR and LAMP

MethodsPrice (per equipment)Price (per reaction)Price (per test, include positive and negative controls)
EquipmentDNA extractionAmplification reagentsDetectionTotal
Quantitative PCRqPCR 30,000–50,000 USD5 USD30 USD105 USD
LAMPTurbidimeter 2000 USD, or heat block (200–1200 USD), or waterbath (50–100 USD)20 USD60 USD

LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction.

Discussion

This assay development was mainly determined to answer the obstetrician’s request for an antenatal screening in rural area. Turbidity-based HBV LAMP coupled with heat treatment method was chosen because of acceptable accuracy, simplified methods, rapidity, and cost-effectiveness. The assay sensitivity to detect HBV DNA was 100 copies/reaction (2 × 105 IU/mL) and no cross detection to other viruses was observed. The positive results can be determined by turbidimeter between 22.76 ± 1.58 and 31.48 ± 1.41 min. In clinical samples, the assay performed 90.12% sensitivity, 83.33% specificity, and 87.40% accuracy comparable to previously developed HBV LAMP assays. Meta-analysis of 12 HBV LAMPs literatures performing 494 cases revealed the average assay sensitivity, and specificity at 0.922 (95% confidence interval [CI]: 0.905–0.937), and 0.860 (95% CI: 0.818–0.896), respectively [22]. Therefore, we concluded that our turbidity-based HBV LAMP coupled with heat treatment method was similarly accurate to the previously developed HBV LAMP methods and can be implemented to the national-level HBV antenatal diagnostic test.

Our turbidity-based HBV LAMP interpreted positive and negative results at the 2 × 105 IU/mL HBV DNA cutoff value at 89.02% and 84.90%, respectively (Table 2). The 2 × 105 IU/mL cutoff value was clinically defined as significant viremia of which initiating an antiviral therapy was highly recommended [4]. Previous HBV LAMP development utilized the fluorescent dye to detect the amplified product [11, 12] and the results were proven equally sensitive and specific to standard qPCR method. However, those fluorescent-based LAMP assays were also developed under qPCR equipment that was unavailable in point-of-care setting. The pricing of qPCR machine and real-time turbidimeter were approximately 15–25 times difference at 30,000–50,000 USD and 2,000 USD, respectively. Moreover, in remote area where turbidimeter could not be procured, the turbidity-based assay coupled with heat treatment method can still be performed using only a heat block and a micro-centrifuge. Positive results can be alternatively detected from direct visualization or spectrophotometer (A650). In addition, we also utilized the heat treatment method to substitute the standard DNA extraction of clinical samples with the objectives to reduce (1) analytical period, (2) dependency of laboratory equipment, (3) the risk of cross-contamination, and (4) the expense of DNA extraction kit. The heat treatment did not interfere with turbidity readouts according to our spiked sera results and the previous report [19].

Several detection platforms were integrated to LAMP such as lateral flow dipstick, enzyme-linked immunosorbent assay (ELISA), and microfluidic chip using antibody-labeled streptavidin–biotin, fluorescent-labeled probes, giant magnetoresistive (GMR) sensors, probe-functionalized nanoparticles, magnetic nanoclusters (MNCs), and line probe assay (LiPA) [9, 23]. Incorporating one of the platforms into LAMP detection system could potentially increase the sensitivity, as well as the cost per reaction. Further assay development toward field implementation might emphasize on reducing interpersonal variation by transferring to lateral flow dipstick or microfluidic chip platform while maintaining with the low price for affordability.

DOI: https://doi.org/10.1515/abm-2019-0021 | Journal eISSN: 1875-855X | Journal ISSN: 1905-7415
Language: English
Page range: 201 - 209
Published on: Oct 1, 2019
In partnership with: Paradigm Publishing Services
Publication frequency: 6 issues per year

© 2019 Saran Pankaew, Sittiporn Pataradilokrat, Jantana Kampeera, Wansika Kiatpathomchai, Kiat Ruxrungtham, Siwaporn Boonyasuppayakorn, published by Chulalongkorn University
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.