A Potential Relationship Between Estrogen Receptors Polymorphisms, Sperm Function and in vitro Fertilization Success: A Preliminary Study*

Talarczyk-Desole, Joanna; Andrusiewicz, Mirosław; Chmielewska, Małgorzata; Berger, Anna; Pawelczyk, Leszek; Jędrzejczak, Piotr; Kotwicka, Małgorzata

A Potential Relationship Between Estrogen Receptors Polymorphisms, Sperm Function and in vitro Fertilization Success: A Preliminary Study*

Postępy Higieny i Medycyny Doświadczalnej

Volume 75 (2021): Issue 1 (January 2021)

By:

Joanna Talarczyk-Desole, Mirosław Andrusiewicz, Małgorzata Chmielewska, Anna Berger, Leszek Pawelczyk, Piotr Jędrzejczak and Małgorzata Kotwicka

Open Access

|May 2021

Figures & Tables

Comparison of median sperm parameters and fertilization rate of conventional IVF and ICSI between the genotypes for ESR1 and ESR2 SNPs

Genotype	Sperm concentration [mln/mL]	Sperm motility [%]	Sperm morphology [%]	HOS [%]	Oocytes fertilized in conventional IVF [%]	Oocytes fertilized in ICSI [%]
Genotype	Sperm concentration [mln/mL]	Sperm motility [%]	Sperm morphology [%]	HOS [%]	Oocytes fertilized in conventional IVF [%]	Oocytes fertilized in ICSI [%]	*ESR1*

PvuII	p = 0.36^a	p = 0.6^a	p = 0.9^a	p = 0.54^a	p = 0.16^a	p = 0.75^a
TT
TC
CC

XbaI	p = 0.31^a	p = 0.71^a	p = 0.33^a	p = 0.78^a	p = 0.73^a	p = 0.97^a
AA
AG
GG

*ESR2*

AluI	p = 0.94^a	p = 0.88^a	p = 0.69^a	p = 0.72^a	p = 0.25^a	p = 0.97^a
AA
AG
GG

RsaI	p = 0.32^b	p = 0.71^b	p = 0.21^b	p = 0.47^b	p = 0.53^b	p = 0.67^b
GG
GA

AlwNI	p = 0.1^b	p = 0.12^a	p = 0.31^a	p = 0.4^a	p = 0.79^a	p = 0.86^a
CC
CT
TT

ESR1 and ESR2 gene primers for PCR

Primer’s name	Sequence 5′ 3′	Annealing temperature	Amplicon length
ESR1_rs9340799_XbaI_FESR1_rs2234693_PvuII_F	CTGCCACCCTATCTGTATCTTTTCCTATTCTCC	71°C	1374 bp
ESR1_rs9340799_XbaI_RESR1_rs2234693_PvuII_R	TCTTTCTCTGCCACCCTGGCGTCGATTATCTGA	71°C	1374 bp
ESR2_rs4986938_AluI_F	GTGTGTGGTGGGACACAGAG	65°C	646 bp
ESR2_rs4986938_AluI_R	AGGCCATTGAGTGTGGAAAC	65°C	646 bp
ESR2_rs1256049_RsaI_F	TTCTGAGCCGAGGTCGTAGT	66°C	582 bp
ESR2_rs1256049_RsaI_R	TGAATCCTTGGACCCAACTC	66°C	582 bp
ESR2_rs1256120_AlwNI_F	GACTTTGTCACACACCTGCG	68°C	620 bp
ESR2_rs1256120_AlwNI_R	AAACAGGCCACCGTCAGAAA	68°C	620 bp

Additional information in studies reporting genetics of infertility_ The format depends on locus biotype and study approach

Information	Input	Source
Reference SNP ID number (rs#)	ESR1 rs2234693, ESR1 rs9340799, ESR2 rs1256120, ESR2 rs1256049, ESR2 rs4986938	dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
Polymorphism biotype	rs2234693, rs9340799 – intron variantrs1256120 – Genic Upstream Transcript Variantrs1256049 – Synonymous Variantrs4986938 – 3 Prime UTR Variant	dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
Minor allele frequency (MAF)	rs2234693 C = 0.46781/125568, TOPMEDrs9340799 G = 0.31393/125568, TOPMEDrs1256120 G = 0.21146/125568, TOPMEDrs1256049 T = 0.06595/246214, GnomADrs4986938 T = 0.31057/239640, GnomAD	dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
P value	0.02	Research
Odds ratio (OR)	n/a	Research
Method / platform - details	PCR-RFLP	Research
Repeat unit	Not applicable	Research
Number of repeats	Not applicable	Research
Gene regulation	Not applicable	Research
MicroRNA (miRBase ID)	Not applicable	Sanger miRBase (http://www.mirbase.org/)
Disease comorbidity, associated syndrome	Not applicable	Research
CNV type	Not applicable	Research
Overlapping gene	Not applicable	Research
Epigenetic mechanism	Not applicable	Research
Chromosomal aberration	Not applicable	Research

Average sperm parameters in patients who underwent conventional IVF and ICSI

	IVF		ICSI
	Mean ± SD	Median	Mean ± SD	Median	p
Concentration [mln/mL]	39±16	40	18±18	13	<0.0001a
Progressive motility [%]	25±9	21	14±10	12	<0.0001a
Correct morphology [%]	5±2	5	3±2	3	<0.0001a
HOS [%]	62±11	63	48±19	50	<0.0001b

Thermal profiles for PCR reactions

Restriction site	XbaI PvuII	AluI	RsaI	AlwNI	Cycles no.
Initial denaturation	95°C, 5 min	95°C, 5 min	95°C, 5 min	95°C, 5 min	1
Denaturation	95°C, 20 s	98°C, 20 s	98°C, 20 s	98°C, 20 s	30
Annealing	71°C, 15 s	65°C, 15 s	66°C, 15 s	68°C, 15 s
Elongation	72°C, 15 s	72°C, 15 s	72°C, 15 s	72°C, 15 s
Final elongation	72°C, 3 min	72°C, 1 min	72°C, 1 min	72°C, 1 min	1

Restriction enzymes and allelic sites for ESR1 and ESR2 genes

Enzyme	Restriction site	Allele	Product length
ESR1_rs9340799_XbaI	T*CTAGA	T*CTAGA	981bp + 393bp
ESR1_rs9340799_XbaI	T*CTAGA	TCTGGA	1374 bp
ESR1_rs2234693_PvuII	CAG*CTG	CAG*CTG	936bp + 438 bp
ESR1_rs2234693_PvuII	CAG*CTG	CAGCCG	1374 bp
ESR2_rs4986938_AluI	AG*CT	AG*CT	445 bp + 201 bp
ESR2_rs4986938_AluI	AG*CT	GGCT	646 bp
ESR2_rs1256049_RsaI	GT*AC	GT*AC	293 bp + 289 bp
ESR2_rs1256049_RsaI	GT*AC	GTGC	582 bp
ESR2_rs1256120_AlwNI	CAGNNN*CTG	CAGNNN*CTG	158 bp + 462 bp
ESR2_rs1256120_AlwNI	CAGNNN*CTG	CAGNNNCCG	620 bp

ESR1 and ESR2 SNPs vs_ sperm parameters

Genotype	Sperm concentration		P	Sperm progressive motility		P	Sperm morphology		P	HOS		P	Normozoospermia		P

	< 15 mln/mL	≥ 15 mln/mL		< 32%	≥ 32%		< 4%	≥ 4%		< 58%	≥ 58%		yes	no
ESR1

PvuII	35	67		77	25		33	69		54	48		23	79

TT	11 (31%)	13 (19%)	0.4^a	19 (25%)	5 (20%)	0.83^a	8 (24%)	16 (23%)	0.98^b	12 (22%)	12 (25%)	0.33^a	5 (22%)	19 (24%)	0.82^a
TC	16 (46%)	36 (54%)		38 (49%)	14 (56%)		17 (52%)	35 (51%)		25 (46%)	27 (56%)		13 (56%)	39 (49%)
CC	8 (23%)	18 (27%)		20 (26%)	6 (24%)		8 (24%)	18 (26%)		17 (32%)	9 (19%)		5 (22%)	21 (27%)

Power^d	0.65			0.24			0.07			0.72			0.25

T	38 (54%)	62 (46%)	0.28^a	76 (49%)	24 (48%)	0.87^a	33 (50%)	67 (49%)	0.85^a	49 (45%)	51 (53%)	0.27^a	23 (50%)	77 (49%)	0.85^a
C	32 (46%)	72 (54%)	0.28^a	78 (51%)	26 (52%)	0.87^a	33 (50%)	71 (51%)	0.85^a	59 (55%)	45 (47%)	0.27^a	23 (50%)	82 (51%)	0.85^a

Power^d	0.63			0.06			0.06			0.63			0.06

XbaI	35	67		77	25		33	69		54	43		23	79

AA	7 (20%)	11 (16%)	0.81^a	15 (19%)	3 (12%)	046^b	7 (21%)	11 (16%)	0.51^a	11 (20%)	7 (15%)	0.75^a	2 (9%)	16 (20%)	0.22^a
AG	14 (40%)	31 (46%)		35 (46%)	10 (40%)		16 (49%)	29 (42%)		23 (53%)	22 (46%)		9 (39%)	36 (46%)
GG	14 (40%)	25 (38%)		27 (35%)	12 (48%)		10 (30%)	29 (42%)		20 (27%)	19 (39%)		12 (52%)	27 (34%)

Power^d	0.21			0.74			0.66			0.70			0.99

A	28 (40%)	53 (40%)	0.95^a	65 (42%)	16 (32%)	0.2^a	30 (46%)	51 (37%)	0 25^a	45 (35%)	36 (38%)	0.54^a	13 (28%)	68 (43%)	0.07^a
G	42 (60%)	81 (60%)	0.95^a	89 (58%)	34 (68%)	0.2^a	36 (64%)	87 (63%)	0 25^a	63 (65%)	60 (62%)	0.54^a	33 (72%)	90 (57%)	0.07^a

Power^d	0.05			0.82			0.73			0.06			0.99

*ESR2*

AluI	31	61		71	21		31	61		49	43		19	73

AA	3 (10%)	5 (8%)	1^b	6 (8%)	2 (10%)	0.49^b	2 (6%)	6 (10%)	0.54^b	5 (10%)	3 (6%)	0.78^b	2 (11%)	6 (8%)	0.21^b
AG	13 (42%)	26 (43%)	1^b	28 (40%)	11 (52%)	0.49^b	11 (36%)	28 (46%)	0.54^b	19 (39%)	20 (47%)	0.78^b	11 (58%)	28 (38%)	0.21^b
GG	15 (48%)	30 (49%)		37 (52%)	8 (38%)		18 (58%)	27 (44%)		25 (51%)	20 (47%)		6 (31%)	39 (54%)

Power^d	0.08			0.67			0.72			0.35			0.72

A	19 (31%)	36 (30%)	0.87^a	40 (28%)	15 (36%)	0.35^a	15 (24%)	40 (33%)	0.23^a	29 (30%)	26 (30%)	0.92^a	15 (39%)	40 (27%)	0.15^a
G	43 (69%)	86 (70%)	0.87^a	102 (72%)	27 (64%)	0.35^a	47 (76%)	82 (67%)	0.23^a	69 (70%)	60 (70%)	0.92^a	23 (61%)	106 (73%)

Power^d	0.06			0.68			0.82			0.05			0.92

RsaI	31	56		67	20		28	59		46	41		18	69

GG	26 (84%)	53 (95%)	0.13^b	60 (90%)	19 (95%)	0.68^b	23 (82%)	56 (95%)	0.11^b	40 (87%)	39 (95%)	0.27^b	17 (94%)	62 (90%)	1^b
GA	5 (16%)	3 (5%)	0.13^b	7 (10%)	l (5%)	0.68^b	5 (18 %)	3 (5%)	0.11^b	6 (13%)	2 (5%)	0.27^b	1 (6%)	7 (10%)	1^b

Power^d	0.8			0.34			0.88			0.6			0.34

G	57 (92%)	109 (97%)	0.14^b	127 (95%)	39 (98%)	0.68^b	51 (91%)	115 (97%)	0.11^b	86 (93%)	80 (98%)	0.28^b	35 (97%)	131 (95%)	1^b
A	5 (8%)	3 (3%)	0.14^b	7 (5%)	1 (2%)	0.68^b	5 (9%)	3 (3%)	0.11^b	6 (7%)	2 (2%)	0.28^b	1 (3%)	7 (5%)	1^b

Power^d	0.68			0.44			0.79			0.73			0.34

A/wM	36	60		74	22		33	63		53	43		20	76

AA	0	4 (7%)	0.21^b	2 (3%)	2 (9%)	0.36^b	0	4 (6%)	0.06^c	1 (2%)	3 (7%)	0.39^b	2 (10%)	2 (3%)	0.23^b
AT	13 (36%)	15 (25%)		23 (31%)	5 (23%)		14 (42%)	14 (22%)		17 (32%)	11 (26%)		4 (20%)	24 (31%)
TT	23 (64%)	41 (68%)		49 (66%)	15 (68%)		19 (58%)	45 (72%)		35 (66%)	29 (67%)		14 (70%)	50 (66%)

Power^d	0.99			0.92			0.99			0.91			0.84

A	13 (18%)	23 (19%)	0.84^a	25 (17%)	7 (16%)	0.94^a	14 (21%)	22 (17%)	0.53^a	19 (18%)	17 (20%)	0.75^a	8 (20%)	28 (18%)	0.82^a
T	59 (82%)	97 (81%)	0.84^a	121 (83%)	35 (84%)	0.94^a	52 (79%)	104 (83%)	0.53^a	87 (82%)	69 (80%)	0.75^a	32 (80%)	124 (82%)	0.82^a

Power^d	0.07			0.07			0.27			0.11			0.11

Minimum checklist of essential information included in the studies reporting genetics of infertility, source databases and examples

Information		Input	Source database
Locus information	Locus biotype/sequence feature/sequence variant	Single nucleotide polymorphism (SNP)	The Sequence ontology (http://www.sequenceontology.org/)
	Sequence ontology accession	SO:0001969, SO:0002153, SO:0001580, SO:0001624	The Sequence ontology (http://www.sequenceontology.org/)
	Locus name / gene symbol	ESR1, ESR2	HGNC (http://www.genenames.org/)
	Gene name	Estrogen receptor 1Estrogen receptor 2	HGNC (http://www.genenames.org/)
	Entrez Gene ID	2099 (ESR1); 2100 (ESR2)	Entrez (www.ncbi.nlm.nih.gov)
	Chromosome number	6 (ESR1); 14 (ESR2)	Ensembl (http://www.ensembl.org)
	Genomic coordinate of the polymorphism, locus	Chromosome # 6q25.1-q25.2 (ESR1)151656691-152,129619 (protein coding gene) (ESR1)151842246-151842246 (SNP)151842200-151842200 (SNP)Chromosome # 14q23.2-q23.3 (ESR2)64084232-64338112 (protein coding gene) (ESR2)64338283-64338283 (SNP)64257333-64257333 (SNP)64233098-64233098 (SNP)	dbSNP (http://www.ncbi.nlm.nih.gov/SNP/) (SNP) Ensembl (http://www.ensembl.org) (gene)
Subjects	Race / ethnicity	Caucasian, Polish	Research
Subjects	Number of participants (infertile/controls) - include sex in each group I(M/F) C(M/F)	Total study population N= 116Group 1= 40, Group 2 = 76 Only males in each group	Research
	Methodology	PCR followed by restriction length fragment polymorphism (PCR-RFLP)	Research
Phenotype information	Clinical data	Male patients: exclusion criteria: azoospermia, hypogonadotropic hypogonadism; erectile disorders. inclusion criteria: sperm samples provided in the process of masturbation.IVF: oocytes fertilized in standard in vitro fertilization methodICSI: oocytes fertilized by intracytoplasmic sperm injectionInclusion criteria: obtaining at least two mature oocytes from ovarian punctureExclusion criteria were as follows: over 39 years of age, FSH >12 mIU/mL.PCS, endometriosis (grade 3 or 4).	Research
	Disease ontology	5223	Disease Ontology (http://disease-ontology.org/)
	Disease comorbidity	Not available	Research
	PubMed ID (in review papers)	No review paper referenced in the paper	Research
Reference	Reference (in review papers)	No review paper referenced in the paper	Research

ESR1 and ESR2 SNPs vs_ fertilization success in conventional IVF and ICSI

Genotype	Conventional IVF	Fertilization completed	No fertilization	p	ICSI	Fertilization completed	No fertilization	p
*ESR1*
PvuII	36	29	7		66	61	5
TT	6 (17%)	6 (21%)	0	0.02c	18 (27%)	16 (26%)	2 (40%)	0.84^a
TC	20 (55%)	18 (62%)	2 (29%)		32 (48%)	30 (50%)	2 (40%)
CC	10 (28%)	5 (17%)	5 (71%)		16 (24%)	15 (24%)	1 (20%)
Power^d		0.99			0.64
T	32 (44%)	30 (52%)	2 (36%)	0.02b	68 (52%)	62 (51%)	6 (60%)	0.75^b
C	40 (56%)	28 (48%)	12 (64%)	0.02b	64 (48%)	60 (49%)	4 (40%)	0.75^b
Power^d		0.77			0.06
XbaI	36	29	7		66	61	5
AA	4 (12%)	3 (10%)	1 (14%)	0.61a	14 (21%)	13 (21%)	1 (20%)	0.16^a
AG	16 (44%)	14 (49%)	2 (29%)		29 (44%)	27 (45%)	2 (40%)
GG	16 (44%)	12 (41%)	4 (57%)		23 (35%)	21 (34%)	2 (40%)
Power^d		0.57			0.14
A	24 (33%)	20 (34%)	4 (29%)	0.76b	57 (43%)	53 (43%)	4 (40%)	1^b
G	48 (67%)	38 (66%)	10 (71%)	0.76b	75 (57%)	69 (57%)	6 (60%)	1^b
Power^d		0.14			0.06
*ESR2*
AluI	31	24	7		61	56	5
AA	2 (6%)	1 (4%)	1 (14%)	0.64a	6 (10%)	5 (9%)	1 (20%)	0.63^a
AG	14 (45%)	11 (46%)	3 (43%)		25 (41%)	23 (41%)	2 (40%)
GG	15 (49%)	12 (50%)	3 (43%)		30 (49%)	28 (50%)	2 (40%)
Power^d		0.72			0.79
A	18 (29%)	13 (27%)	5 (36%)	0.52b	37 (30%)	33 (29%)	4 (40%)	0.48^b
G	44 (71%)	35 (73%)	9 (64%)	0.52b	85 (70%)	79 (71%)	6 (60%)	0.48^b
Power^d		0.36				0.76
RsaI	30	29	1		57	50	7	-
GG	24 (80%)	23 (79%)	1 (100%)	-	53 (93%)	46 (92%)	7 (100%)
GA	6 (20%)	6 (21%)	0		4 (7%)	4 (8%)	0
Power^d		-			-
G	54 (90%)	52 (90%)	2 (100%)	-	110 (96%)	96 (96%)	14 (100%)	-
A	6 (10%)	6 (10%)	0		4 (4%)	4 (4%)	0	-
Power^d		-			-
AlwNI	30	24	6		66	61	5
CC	2 (13%)	2 (8%)	0	1c	2 (3%)	2 (3%)	0	0.28^c
CT	5 (17%)	4 (17%)	1 (17%)		23 (35%)	23 (38%)	0
TT	23 (70%)	18 (75%)	5 (83%)		41 (62%)	36 (59%)	5 (100%)
Power^d		0.29			0.99
C	9 (15%)	8 (17%)	1 (8%)	0.67b	27 (20%)	27 (22%)	0	-
T	51 (85%)	40 (83%)	11 (92%)	0.67b	105 (80%)	95 (78%)	10 (100%)	-
Power^d		0.46			-

DOI: https://doi.org/10.5604/01.3001.0014.8782 | Journal eISSN: 1732-2693

Journal RSS Feed

Language: English

Page range: 304 - 316A

Submitted on: Oct 23, 2019

Accepted on: Jul 31, 2020

Published on: May 12, 2021

Published by: Hirszfeld Institute of Immunology and Experimental Therapy

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

male infertility,

estrogen receptors,

single nucleotide polymorphisms (SNPs),

IVF – fertilization,

ICSI – intracytoplasmic sperm injection

Related subjects:

Life sciences,

Molecular biology,

Microbiology and virology,

Medicine,

Basic medical science,

Immunology

© 2021 Joanna Talarczyk-Desole, Mirosław Andrusiewicz, Małgorzata Chmielewska, Anna Berger, Leszek Pawelczyk, Piotr Jędrzejczak, Małgorzata Kotwicka, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous article Volume 75 (2021): Issue 1 (January 2021)Next article