Investigating the Prevalence of Penaeus Monodon Densovirus Infection in Selected Shrimp Farms in Chilaw, Sri Lanka

Penaeus monodon Densovirus (PmDNV) infects the hepatopancreas of penaeid shrimp and causes an asymptomatic disease. Heavy infections cause stunted growth, leading to a decline in farm production. While PmDNV is widely distributed worldwide, there is no record of its prevalence in Sri Lanka. This study aimed to detect PmDNV in Penaeus monodon in Chilaw region of Sri Lanka. Forty (n=40) shrimp samples, aged 94-105 days, were collected from four selected farms (A, B, C and D) in Chilaw. The hepatopancreas of shrimp was isolated, and separate sections were preserved in Davidson’s fixative solution for histopathology and in 70% ethanol for DNA extraction. Fixed tissue samples were stained with Hematoxylin and Eosin (H&E), and infected hepatopancreas revealed hepatopancreatic cell necrosis and intranuclear inclusion bodies. DNA extraction was done according to the protocol of the Wizard Genomic DNA purification kit, and PCR was carried out using forward (5’AATCTGCAGGGTACGGAAAAAAC³’) and reverse (5’TGTGGAACCATCTCAAATGCC ³’) primers. The study found that 60% (24/40) of the shrimp were infected with PmDNV, and 27.5% of the samples were negative for the virus. From the studied samples, 12.5% of the samples did not show any bands in PCR. The severity of infection was assessed using band intensity, which revealed that 20% of samples were severely infected and that the majority (37.5%) were moderately infected. No significant difference was observed in the mean body weight and total length of infected and non-infected shrimps. Shrimp growth was not affected due to the moderate level of PmDNV infection.