Skip to main content
Have a personal or library account? Click to login
Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India Cover

Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India

Open Access
|Mar 2025

Figures & Tables

graphic/j_pjm-2025-008_ufig_001.jpg
Fig. 1.

Broth microdilution method for the detection of colistin-resistant bacteria.

Vertical Lane A is a negative control, B is an in-house positive control, and C-H is processed bacteria for the identification of colistin resistance, while horizontal lanes from 1–8 show the dilution of colistin sulfate from 0.5 μg/ml to 16 μg/ml, lane 7 is growth control and 8 is media control.

Table I

The primers used for the targeted gene.

Sr. No.mcr genesAmplicon size (bp)Primer sequences (5’–3’)*
1.mcr-1320F: AGTCCGTTTGTTCTTGTGGC
R: AGATCCTTGGTCTCGGCTTG
2.mcr-2700F: CAAGTGTGTTGGTCGCAGTT
R: TCTAGCCCGACAAGCATACC
3.mcr-3900F: AAATAAAAATTGTTCCGCTTATG
R: AATGGAGATCCCCGTTTTT
4.mcr-41,100F: TCACTTTCATCACTGCGTTG
R: TTGGTCCATGACTACCAATG
5.mcr-51,644F: ATGCGGTTGTCTGCATTTATC
R: TCATTGTGGTTGTCCTTTTCTG

1* – Primer Source (Eurofins Genomics India Pvt. Ltd., India)

Fig. 2.

Identification of mcr 1–5 genes in colistin-resistant Gram-negative bacteria by multiplex PCR.

Bacterial plasmid DNA was isolated by boiling method and the mcr 1–5 genes were identified by multiplex PCR and further visualized by gel electrophoresis. Lane (L): 50 bp ladder; Lane (1, 2, 3, 4, 5): samples; Lane (6): negative control; Lane (7): positive control.

Fig. 3.

Flowchart showing the study schedule.

*MDR – multidrug resistance, **PCR – polymerase chain reaction

Table II

Demographic characteristics and risk factors associated with colistin-resistant Gram-negative bacteria.

Demographic characteristicsMDR-GNB (n = 995) (%)Colistin resistance (n = 57) (%)Level of significance (Chi-square test)
Age (years)0–20 years64 (6%)08 (13%)0.0816
21–40 years279 (28%)15 (5%)
41–60 years361 (36%)23 (6%)
Above 60 years291 (29%)11 (4%)
GenderMale602 (61%)46 (8%)0.2439
Female393 (39%)11 (3%)
ResidenceRural724 (73%)40 (6%)0.6699
Urban271 (27%)17 (6%)
EducationaIntermediate level530 (55%)47 (9%)< 0.0001
bUndergraduate level357 (37%)06 (2%)
cGraduate level or higher108 (6%)01 (2%)
Risk factors associated with colistin resistance
Duration of hospital stayLess than 48 h19(2%)< 0.001***
2–5 days99 (10%)
5–15 days368 (37%)1 (2%)
> 15 days509 (51%)56 (98%)
History of previous hospitalization for more than 5 days with beta-lactam antibiotics448 (45%)41 (72%)0.0264*
Diabetes278 (28%)32 (56%)0.0021**
Chronic heart disease (CHD)139 (14%)1 (2%)0.0151*
Chronic obstructive pulmonary disease (COPD)265 (27%)11 (19 %)0.0061**
Chronic renal disease (CRD)129 (13%)4 (7%)0.2358

1*, **, *** – denotes significant differences at p < 0.05, p < 0.01, p < 0.001, respectively

1 a – Intermediate level – 10 + 2, b – Undergraduate level-Bachelor’s degree,

1 c – Graduate level –Master’s degree or higher

Table III

Distribution of multidrug resistance and colistin-resistant Gram-negative bacilli in various samples.

SpecimensGram-negative isolates (n = 2,237) (%)*MDR GNB (n = 995) (%)Colistin resistant bacteria (n = 57) (%)
Blood402 (18%)112 (28%)9 (8%)
Sputum419 (19%)151 (36%)9 (6%)
Urine811 (34%)560 (69%)25 (4%)
Wound swab165 (10%32 (19%)2 (6%)
Pus322 (14%)137 (43%)12 (9%)
Endotracheal swab46 (2%)02 (4%)
Vaginal Swab72 (3%)01 (1%)

1* MDR GNB – Multidrug resistant Gram-negative bacilli

Fig. 4.

Distribution of multidrug-resistant Gram-negative bacilli isolated from different clinical specimens collected across various inpatient departments.

Table IV

Antibiotic-resistance rate (in percentage) among multidrug-resistant Gram-negative bacilli.

AntibioticsEscherichia coli (n = 481) (%)Klebsiella pneumoniae (n = 265) (%)Klebsiella oxytoca (n = 15) (%)Pseudomonas aeruginosa (n = 157) (%)Pseudomonas spp. (n = 06) (%)Acinetobacter spp. (n = 70) (%)Citrobacter freundii (n = 1) (%)
Amoxycillin/Clavulanic acid257 (53%)189 (71%)13 (87%)NDNDNDND
Piperacillin/tazobactam200 (42%)176 (66%)12 (80%)85 (54%)4 (67%)62 (89%)
Cefotaxime455 (95%)251 (94%)14 (93%)24 (86ND*7 (88%)1 (100%)
Ceftriaxone405 (84%)239 (90%)13 (87%)110 (70%)4 (67%)59 (84%)
Cefepime93 (78%)198 (75%)14 (93%)115 (73%)4 (67%)65 (93%)ND
Imipenem399 (82%)223 (84%)11 (73%)104 (66%)5 (83%)68 (97%)1 (100%)
Meropenem193 (40%)127 (48%)8 (53%)82 (52%)4 (67%)57 (81%)1 (100%)
Gentamicin218 (45%)150 (7%)8 (53%)79 (50%)4 (67%)60 (86%)1 (100%)
Amikacin79 (16%)85 (32%)8 (53%)72 (46%)4 (67%)36 (51%)
Ciprofloxacin450 (94%)229 (86%)14 (93%)110 (70%)5 (83%)68 (97%)1 (100%)
Cotrimoxazole257 (53%)175 (66%)09 (60%)143 (91%)05 (83%)59 (84%)

1 ND – not done

Table V

Determination of colistin minimum inhibitory concentration (MICs) of different MDR Gram-negative isolates by Broth Micro Dilution method.

MICs of colistin (n = 995)Klebsiella spp. (n = 280) (%)Escherichia coli (n = 481) (%)Pseudomonas spp. (n = 163) (%)Acinetobacter spp. (n = 70) (%)Citrobacter freundii (n = 1) (%)
≤ 0.5 μg/ml207 (74%)415 (86%)99 (61%)28 (40%)
1 μg/ml17 (6%)23 (5%)36 (22%)30 (43%)
2 μg/ml43 (16%)27 (6%)09 (6%)04 (6%)
4 μg/ml09 (3%)06 (1%)17 (10%)06 (9%)01 (100%)
8 μg/ml03 (1%)6 (1%)01 (0.61%)01 (1%)
≥ 16 μg/ml01 (0.36%)04 (0.82%)01 (0.61%)01 (14%)
Table VI

Antibiotic sensitivity pattern of colistin-resistant bacteria (n = 57).

AntibioticsEscherichia coli (n = 16) (%)Klebsiella pneumoniae (n = 13) (%)Pseudomonas aeruginosa (n = 19) (%)Acinetobacter spp. (n = 8) (%)Citrobacter freundii (n = 1) (%)
Amoxicillin/clavulanic acid7 (44%)1 (8%)NDND
Piperacillin/tazobactam5 (31%)6 (32%)1 (17%)1 (100%)
Cefotaxime1 (6%)ND
Ceftriaxone2 (13%)3 (16%)1 (100%)
Cefepime2 (13%)1 (5%)ND
Imipenem
Meropenem3 (9%)2 (11%)4 (50%)
Gentamicin8 (50%)5 (38%)7 (37%)2 (33%)
Amikacin13 (81%)5 (38%)10 (53%)6 (86%)1 (100%)
Ciprofloxacin3 (19%)1 (8%)2 (11%)1 (14%)
Cotrimoxazole10 (63%)4 (30%)01 (13%)
DOI: https://doi.org/10.33073/pjm-2025-008 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 95 - 105
Submitted on: Aug 19, 2024
Accepted on: Feb 5, 2025
Published on: Mar 26, 2025
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2025 Shubham Chauhan, Pottathil Shinu, Narinder Kaur, Adesh K. Saini, Rosy Bala, Anroop B. Nair, Aminur Rahman, Mohamed A. Morsy, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.