Methodological Evaluation of Carbapenemase Detection by Different Methods

Gao, Nana; Zhou, Jing; Li, Ge; Liu, Runde; Lu, Guoping; Shen, Jilu

Methodological Evaluation of Carbapenemase Detection by Different Methods

Polish Journal of Microbiology

Volume 73 (2024): Issue 3 (September 2024)

By:

Nana Gao, Jing Zhou, Ge Li, Runde Liu, Guoping Lu and Jilu Shen

Open Access

|Sep 2024

Figures & Tables

Apb/EDTA method for the detection of carbapenemase

A) Electrophoretic bands showed positive KPC; B) electrophoretic bands showed positive NDM

NG-test Carba 5 demonstration of carbapenemase detection.

A represents the fluorescence diagram of DETECTR for pre-experimental detection of KPC gene NDM gene amplification, and B represents the partial fluorescence display diagram of carbapenemase detection with DETECTR.

Characterization of five carbapenemase methods for detecting specimen No. 36.
A) mAPB/EDTA method (panel A) ertapenem (10 mg), 6 mm; (panel B) ertapenem plus APB (300 mg), 6 mm; (panel C) ertapenem plus EDTA (292 mg), ≥ 11 mm; (panel D) ertapenem plus APB and EDTA, ≥ 11 mm; judged as carbapenemase category B positive. B) PCR: NDM negative. C) NG-test Carba 5: NDM negative. D) GeneXpert Carba-R: NDM positive. E) DETECTR: NDM positive. — Characterization of five carbapenemase methods for detecting specimen No. 36. A) mAPB/EDTA method (panel A) ertapenem (10 mg), 6 mm; (panel B) ertapenem plus APB (300 mg), 6 mm; (panel C) ertapenem plus EDTA (292 mg), ≥ 11 mm; (panel D) ertapenem plus APB and EDTA, ≥ 11 mm; judged as carbapenemase category B positive. B) PCR: NDM negative. C) NG-test Carba 5: NDM negative. D) GeneXpert Carba-R: NDM positive. E) DETECTR: NDM positive.

Results of carbapenemase detection using five assays_

No.	WGS	APB/EDTA	NG-test Carba 5	PCR	DETECTR	geneXpert
1–7381-kp	KPC-2	category A	KPC	KPC	KPC	KPC
2–7592-kp	KPC-2	category A	KPC	KPC	KPC	KPC
3–4619-kp	NDM-1	category B	NDM	NDM	NDM	NDM
4–7135-kp	KPC-2	category A	KPC	KPC	KPC	KPC
5–7056-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
6–4375-kp	NDM-1	category B	NDM	NDM	NDM	NDM
7–6553-kp	KPC-2	category A	KPC	KPC	KPC	KPC
8–8247-kp	KPC-2	category A	KPC	KPC	KPC	KPC
9-8046-kp	KPC-2	category A	KPC	KPC	KPC	KPC
10-9261-kp	NDM-1	category B	NDM	NDM	NDM	NDM
11-4963-kp	NDM-1	category B	NDM	NDM	NDM	NDM
12-6310-kp	NDM-1	category B	NDM	NDM	NDM	NDM
13-7353-kp	NDM-1	category B	NDM	NDM	NDM	NDM
14-4530-kp	NDM-1	category B	NDM	NDM	NDM	NDM
15-4658-kp	NDM-1	category B	NDM	NDM	NDM	NDM
16-6441-kp	NDM-1	category B	NDM	NDM	NDM	NDM
17-7984-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
18-8961-kp	KPC-2	category A	KPC	KPC	KPC	KPC
19-7862-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
20-8024-kp	KPC-2	category A	KPC	KPC	KPC	KPC
21-7926-kp	KPC-2	category A	KPC	KPC	KPC	KPC
22-4420-kp	NDM-1	category B	NDM	NDM	NDM	NDM
23-8986-kp	KPC-2	category A	KPC	KPC	KPC	KPC
24-9990-kp	KPC-2	category A	KPC	KPC	KPC	KPC
25-7005-kp	NDM-1	category B	NDM	NDM	NDM	NDM
26-7615-kp	KPC-2	category A	KPC	KPC	KPC	KPC
27-4480-kp	KPC-2	category A	KPC	KPC	KPC	KPC
28-9899-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
29-4650-kp	KPC-2	category A	KPC	KPC	KPC	KPC
30-7972-kp	KPC-2	category A	KPC	KPC	KPC	KPC
31-6993-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
32-4610-kp	KPC-2	category A	KPC	KPC	KPC	KPC
33-7985-kp	KPC-2	category A	KPC	KPC	KPC	KPC
34-7407-kp	NDM-1	category B	NDM	NDM	NDM	NDM
35-4812-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
36-7467-kp	NDM-1	category B	Not detected	Not detected	NDM	NDM
37-7973-kp	KPC-2	category A	KPC	KPC	KPC	KPC
38-6887-kp	NDM-1	category B	NDM	NDM	NDM	NDM
39-6186-kp	KPC-2	category A	KPC	KPC	KPC	KPC
40-9059-kp	KPC-2	category A	KPC	KPC	KPC	KPC
41-7519-kp	KPC-2	category A	KPC	KPC	KPC	KPC
42-8918-kp	NDM-1	category B	NDM	NDM	NDM	NDM
43-9777-kp	KPC-2	category A	KPC	KPC	KPC	KPC
44-6434-kp	KPC-2	category A	KPC	KPC	KPC	KPC
45-6440-kp	NDM-1	category B	NDM	NDM	NDM	NDM
46-7820-kp	KPC-2	category A	KPC	KPC	KPC	KPC
47-6071-kp	KPC-2	category A	KPC	KPC	KPC	KPC
48-6322-kp	KPC-2	category A	KPC	KPC	KPC	KPC
49-4865-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
50-8052-kp	NDM-1	category B	NDM	NDM	NDM	NDM
51-4906-kp	KPC-2	category A	KPC	KPC	KPC	KPC
52-7979-kp	KPC-2	category A	KPC	KPC	KPC	KPC
53-4669-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM
54-4947-kp	NDM-1	category B	NDM	NDM	NDM	NDM
55-7052-kp	NDM-1	category B	NDM	NDM	NDM	NDM
56-10015-kp	NDM-1	category B	NDM	NDM	NDM	NDM
57-4919-kp	KPC-2	category A	KPC	KPC	KPC	KPC
58-7380-E. coli	NDM-1	category B	NDM	NDM	NDM	NDM

Oligonucleotide sequences used in this study_

Primer name	Sequence (5’–3’)	Size of product (bp)	References
KPC-F	ATCTCGGAAAAATATCTGACAACAGGCATGACGGTG	309	[14]
KPC-R	CGGTCGTGTTTCCCTTTAGCCAATCAACAAAACTGCT
NDM-F	TCGCACCGAATGTCTGGCAGCACACTTCCTAT	278	[14]
NDM-R	GTTCGACAACGCATTGGCATAAGTCGCAATCC

Xpert Carba-R assay results by target carbapenemase genes_

Xpert Carba-R assay results	Specimens (n = 58)
KPC	29
IMP	0
NDM	29
OXA-48	0
VIM	0

Carbapenemase-resistant spectra of the 58 strains_

Antimicrobial	S	I	R
Amikacin	36	–	22
Ertapenem	–	–	58
Imipenem	1	–	57
Meropenem	–	1	57
Cefazolin	–	1	57
Ceftazidime and avibactam	20	–	38
Cefepime	–	–	58
Aztreonam	12	–	46
Amoxicillin and clavulanate potassium	–	1	57
Polymyxin	57	–	1
Levofloxacin	2	9	47
Tigecycline	50	1	7

DOI: https://doi.org/10.33073/pjm-2024-034 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331

Journal RSS Feed

Language: English

Page range: 383 - 394

Submitted on: Jun 12, 2024

Accepted on: Jul 31, 2024

Published on: Sep 13, 2024

Published by: Polish Society of Microbiologists

In partnership with: Paradigm Publishing Services

Publication frequency: 4 times per year

Keywords:

rapid detection,

WSG,

DETECTR,

methodological evaluation

Related subjects:

Life sciences,

Microbiology and virology

© 2024 Nana Gao, Jing Zhou, Ge Li, Runde Liu, Guoping Lu, Jilu Shen, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous article Volume 73 (2024): Issue 3 (September 2024)Next article

Methodological Evaluation of Carbapenemase Detection by Different Methods

Figures & Tables

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Results of carbapenemase detection using five assays_

Oligonucleotide sequences used in this study_

Xpert Carba-R assay results by target carbapenemase genes_

Carbapenemase-resistant spectra of the 58 strains_

Paradigm

My account