Have a personal or library account? Click to login
Epidemiological Characteristics of Shiga Toxin-Producing Escherichia coli Responsible for Infections in the Polish Pediatric Population Cover

Epidemiological Characteristics of Shiga Toxin-Producing Escherichia coli Responsible for Infections in the Polish Pediatric Population

Open Access
|May 2024

Figures & Tables

Fig. 1.

Antibiotic susceptibility of STEC isolates (n = 33).
AMC – amoxicillin/clavulanic acid, TZP – piperacillin/tazobactam, CTX – cefotaxime, CXM – cefuroxime, CAZ – ceftazidime, FEP – cefepime, IPM – imipenem, MEM – meropenem, AK – amikacin, CN – gentamicin, TOB – tobramycin, CIP – ciprofloxacin, SXT – trimethoprim/sulfamethoxazole, AZT – azithromycin.
Antibiotic susceptibility of STEC isolates (n = 33). AMC – amoxicillin/clavulanic acid, TZP – piperacillin/tazobactam, CTX – cefotaxime, CXM – cefuroxime, CAZ – ceftazidime, FEP – cefepime, IPM – imipenem, MEM – meropenem, AK – amikacin, CN – gentamicin, TOB – tobramycin, CIP – ciprofloxacin, SXT – trimethoprim/sulfamethoxazole, AZT – azithromycin.

Fig. 2.

Percentage of STEC isolates by month, 2018–2022 (n = 45).
Percentage of STEC isolates by month, 2018–2022 (n = 45).

Fig. 3.

PFGE patterns of selected Escherichia coli isolates. Original designations of the isolates and their PFGE types are shown above the corresponding lanes. Salmonella Branderup and γ ladder (New England Biolabs, USA) were used as PFGE molecular weight markers. Results of the analysis of genetic relatedness of STEC strains, 2018-2022.
PFGE patterns of selected Escherichia coli isolates. Original designations of the isolates and their PFGE types are shown above the corresponding lanes. Salmonella Branderup and γ ladder (New England Biolabs, USA) were used as PFGE molecular weight markers. Results of the analysis of genetic relatedness of STEC strains, 2018-2022.

Characteristics of primers and probes used in the study_

Gene nameGenBank Access No.Nucleotide sequences (5’→3’)*Amplicon size (bp)
sxt1M16625Fw**: TTTGTYACTGTSACAGCWGAAGCYTTACG132
Rv**: CCCCAGTTCARWGTRAGRTCMACRTC
Probe: CTGGATGATCTCAGTGGGCGTTCTTATGTAA
sxt2X07865Fw: TTTGTYACTGTSACAGCWGAAGCYTTACG128
Rv: CCCCAGTTCARWGTRAGRTCMACRTC
Probe: TCGTCAGGCACTGTCTGAAACTGCTCC
uhZ11541Fw: CATTGATCAGGATTTTTCTGGTGATA102
Rv: CTCATGCGGAAATAGCCGTTA
Poll: ATAGTCTCGCCAGTATTCGCCACCAATACC

Characteristics of patients infected with STEC as diagnosed in the Medical Center of the Medical University of Warsaw, 2018–2022_

Characteristic of STEC patientsValue (No.)
Boys26
Girls19
Median age (range)2 years 8 months (1 month–16 years and 6 months)
Clinical manifestationValue (No.)
HUS20
Only diarrhea4
No data21
Laboratory resultsNo. cases/No. total
Direct positive PCR for stx1 and/or -2 from stool45/45
Positive culture of STEC44/45
PCR gene detection resultsNo. cases/No. total
stx11 positive, stx22 negative3/45
stx1 negative, stx2 positive38/45
stx1 positive, stx2 positive3/45
stx – unknown stx type1/45
eaeA344/45
SerotypesNo. total
O15740
other than O1571

Molecular characteristic of selected isolates derived from gastrointestinal infections_

PFGE type/subtypeNo. of isolates (Total No. 24)stx1, stx2 gene presenceVoivodeship
B1, D, E, F, G, I, J, M, N, O, Q11stx2Podlaskie
A1, A2, B2, C1, C2, H, K8stx2Mazovian
Citrobacter freundii (no PFGE type)1stx1Mazovian
C1, P, R3stx2Warmian-Masurian
L1stx2Greater Poland
DOI: https://doi.org/10.33073/pjm-2024-016 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 177 - 187
Published on: May 10, 2024
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Dominika Seliga-Gąsior, Beata Sokól-Leszczyñska, Jolanta Krzysztoñ-Russjan, Diana Wierzbicka, Karolina Stępieñ-Hołubczat, Paulina Lewandowska, Ewa Frankiewicz, Andrzej Cacko, Beata Leszczyñska, Urszula Demkow, Edyta Podsiadły, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.