Have a personal or library account? Click to login
Establishment of RPA-Cas12a-Based Fluorescence Assay for Rapid Detection of Feline Parvovirus Cover

Establishment of RPA-Cas12a-Based Fluorescence Assay for Rapid Detection of Feline Parvovirus

Polish Journal of Microbiology
Volume 73 (2024): Issue 1 (March 2024)
By: Ting Wang,  Hao Zeng,  Qiming Liu,  Weidong Qian,  Yongdong Li,  Jian Liu and  Rong Xu  
Open Access
|Mar 2024

Figures & Tables

Fig. 1.

The schematic flow of RPA-Cas12a-based fluorescence assay for the detection of feline parvovirus virus (FPV) by combining recombinase polymerase amplification (RPA) and CRISPR/Cas12a (A). The genomic DNA of FPV was extracted from clinical samples and amplified using RPA to prepare double-stranded DNA (dsDNA) at 37°C. Then, CRISPR/Cas12a was activated by the complex of amplified products of the target gene, Cas12a, and crRNA, and the single-stranded DNA molecules (ssDNA reporter) were cut to produce fluorescence signals. Finally, the readout of the RPA-Cas12a-fluorescence assay was obtained using real-time or end-point fluorescence and naked eyes using the corresponding simple device. Visualization of primers for RPA and crRNA spacer sites to detect Cas12a within the target nonstructural protein 1 (NS1) gene of FPV genome (B). Primers and crRNA are indicated by red and yellow colored text, respectively.
The schematic flow of RPA-Cas12a-based fluorescence assay for the detection of feline parvovirus virus (FPV) by combining recombinase polymerase amplification (RPA) and CRISPR/Cas12a (A). The genomic DNA of FPV was extracted from clinical samples and amplified using RPA to prepare double-stranded DNA (dsDNA) at 37°C. Then, CRISPR/Cas12a was activated by the complex of amplified products of the target gene, Cas12a, and crRNA, and the single-stranded DNA molecules (ssDNA reporter) were cut to produce fluorescence signals. Finally, the readout of the RPA-Cas12a-fluorescence assay was obtained using real-time or end-point fluorescence and naked eyes using the corresponding simple device. Visualization of primers for RPA and crRNA spacer sites to detect Cas12a within the target nonstructural protein 1 (NS1) gene of FPV genome (B). Primers and crRNA are indicated by red and yellow colored text, respectively.

Fig. 2.

Examination of optimal crRNA for RPA-Cas12a-based fluorescence assay for the detection of FPV. The fluorescence readouts of RPA-Cas12a-fluorescence real-time (A) and end-point (B) assay were shown using different crRNA or a combination of crRNA for 30 min at 37°C, respectively. Error bars represent the standard deviation of the data (n = 3). Statistical analysis was applied to evaluate the statistical significance between treated groups and the negative control (NC). **p < 0.05, ***p < 0.001, and n.s. – no significant differences
Examination of optimal crRNA for RPA-Cas12a-based fluorescence assay for the detection of FPV. The fluorescence readouts of RPA-Cas12a-fluorescence real-time (A) and end-point (B) assay were shown using different crRNA or a combination of crRNA for 30 min at 37°C, respectively. Error bars represent the standard deviation of the data (n = 3). Statistical analysis was applied to evaluate the statistical significance between treated groups and the negative control (NC). **p < 0.05, ***p < 0.001, and n.s. – no significant differences

Fig. 3.

Examination of sensitivity of RPA-Cas12a-based fluorescence assay. An increase in the fluorescence intensity with increasing the template concentration of the target gene from 0.1 to 100 copies/μl was observed according to real-time (A) and end-point (B) fluorescence readouts. In addition, the color shift between 1 or higher and 0.1 or lower copies/μl was visualized by the naked eye (C). Error bars represent the standard deviation of the data (n = 3). Statistical analysis was used to assess the difference between treated groups and the corresponding time point of negative control (NC). **p < 0.05, *** p < 0.001, and n.s. – no significant differences
Examination of sensitivity of RPA-Cas12a-based fluorescence assay. An increase in the fluorescence intensity with increasing the template concentration of the target gene from 0.1 to 100 copies/μl was observed according to real-time (A) and end-point (B) fluorescence readouts. In addition, the color shift between 1 or higher and 0.1 or lower copies/μl was visualized by the naked eye (C). Error bars represent the standard deviation of the data (n = 3). Statistical analysis was used to assess the difference between treated groups and the corresponding time point of negative control (NC). **p < 0.05, *** p < 0.001, and n.s. – no significant differences

Fig. 4.

Assessment of specificity of RPA-Cas12a-based fluorescence assay. The specificity of RPA-Cas12a-based fluorescence assay for FPV detection was investigated using genomic DNA extracted from FPV, feline calicivirus/Cat/Shanghai/01/2021 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline Mycoplasma felis ATCC® 23391™ (MYC), and Chlamydia psittaci ATCC® VR-120™ (CP) as the template. Only FPV produced fluorescence signals according to real-time (A), end-point (B) fluorescence, and the naked eye (C) readouts. Error bars indicate the standard deviations of the data (n = 3). Statistical analysis was used to examine the difference between treated groups and negative control (NC). ***p < 0.001, and n.s. – no significant differences
Assessment of specificity of RPA-Cas12a-based fluorescence assay. The specificity of RPA-Cas12a-based fluorescence assay for FPV detection was investigated using genomic DNA extracted from FPV, feline calicivirus/Cat/Shanghai/01/2021 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline Mycoplasma felis ATCC® 23391™ (MYC), and Chlamydia psittaci ATCC® VR-120™ (CP) as the template. Only FPV produced fluorescence signals according to real-time (A), end-point (B) fluorescence, and the naked eye (C) readouts. Error bars indicate the standard deviations of the data (n = 3). Statistical analysis was used to examine the difference between treated groups and negative control (NC). ***p < 0.001, and n.s. – no significant differences

Statistical analysis of FPV detection in clinical samples using the RPA-Cas12a-based fluorescence assay and qPCR_ The difference was statistically significant, as determined via the DiagnosticTest using openepi software_

qPCRPositiveNegativeTotalConsistency rate
RPA-Cas12a-based fluorescencePositive2802896.67%
Negative 23032
Total303060

The oligonucleotide sequences for primers and crRNA for the RPA-Cas12a-based fluorescence assay of FPV_

Oligonucleotide nameSequence (5′–3′)
NS1-F1AATGATGGCACAACCAGGAGGTGAAAATCTT
NS1-R1ATCCAATTCCATCCGTGCATTCTAAAAATTT
NS1-F2TTAGAATGCACGGATGGAATTGGATTAAAG
NS1-R2CCACAGCTTGTGCTATGGCTTGAGCAATAA
NS1-F3TGATGGCACAACCAGGAGGTGAAAATCTTT
NS1-R3AATCCAATTCCATCCGTGCATTCTAAAAAT
NS1-F4TTTAGAATGCACGGATGGAATTGGATTAAAG
NS1-R4CACAGCTTGTGCTATGGCTTGAGCAATAAT
ssDNA reporterFAM-TTATTATT-BHQ
crRNA1-FGAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATGAATGCACGGATGGAATTGG
crRNA1-RCCAATTCCATCCGTGCATTCATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA2-FGAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATAATAGACAAGGTGGTAAAAG
crRNA2-RCTTTTACCACCTTGTCTATTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA3-FGAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATAATTAATACTTGAAAAAGCA
crRNA3-RTGCTTTTTCAAGTATTAATTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA4-FGAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATGACATGTTCTAGAATTTGCA
crRNA4-RTGCAAATTCTAGAACATGTCATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA5-FGAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATCAAGATCAAAGTTAGTTAGT
crRNA5-RACTAACTAACTTTGATCTTGATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
DOI: https://doi.org/10.33073/pjm-2024-005 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Journal RSS Feed
Language: English
Page range: 39 - 48
Submitted on: Sep 27, 2023
|
Accepted on: Dec 29, 2023
|
Published on: Mar 4, 2024
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
CRISPR-Cas12a,
detection,
feline parvovirus,
RPA,
real-time fluorescence
Related subjects:
Life sciences,
Microbiology and virology

© 2024 Ting Wang, Hao Zeng, Qiming Liu, Weidong Qian, Yongdong Li, Jian Liu, Rong Xu, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 73 (2024): Issue 1 (March 2024)Next article