Have a personal or library account? Click to login
A Recombinase-Aided Amplification Assay for the Detection of Chlamydia felis Cover

A Recombinase-Aided Amplification Assay for the Detection of Chlamydia felis

Polish Journal of Microbiology
Volume 72 (2023): Issue 3 (September 2023)
By: Jian Liu,  Weidong Qian,  Jian Wang,  Yilan Bai,  Yaping Gui,  Luming Xia,  Guohua Gong,  Feifei Ge,  Haixiao Shen,  Xiaojing Chang and  Hongjin Zhao  
Open Access
|Sep 2023

Figures & Tables

Fig. 1.

A) Specificity evaluation of the recombinase-aided amplification (RAA) assay for the detection of Chlamydia felis using genomic DNA from C. felis_pUC57 plasmid, feline calicivirus-SH202101 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline parvovirus/Shanghai/01/2021 (FPV), Mycoplasma felis ATCC® 23391™ (M. felis), and Bordetella bronchiseptica ATCC® 4617™ (B. bronchiseptica), as the templates of RAA, respectively.B) Examination of the RAA assay's sensitivity for detecting Chlamydia felis using a serial dilution of the C. felis_pUC57 plasmid as the template. The lower limit of detection was 10.6 copies/reaction plasmid DNA. The higher the template concentration, the greater the fluorescence value and the earlier the peak time. NC, negative control group. All the experiments were performed at least three times.
A) Specificity evaluation of the recombinase-aided amplification (RAA) assay for the detection of Chlamydia felis using genomic DNA from C. felis_pUC57 plasmid, feline calicivirus-SH202101 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline parvovirus/Shanghai/01/2021 (FPV), Mycoplasma felis ATCC® 23391™ (M. felis), and Bordetella bronchiseptica ATCC® 4617™ (B. bronchiseptica), as the templates of RAA, respectively.B) Examination of the RAA assay's sensitivity for detecting Chlamydia felis using a serial dilution of the C. felis_pUC57 plasmid as the template. The lower limit of detection was 10.6 copies/reaction plasmid DNA. The higher the template concentration, the greater the fluorescence value and the earlier the peak time. NC, negative control group. All the experiments were performed at least three times.

Sequences of primers and probes in the RAA assay for Chlamydia felis_*

Primers/ProbesSequence (5′–3′)Genomic position†
C. felis FGAAAGCAAGGGGAGCAAACAGGATT769–793
C. felis RTCAGGCGGCATACTTAACGCGTTAG891–867
C. felis probeCGATGCATACTTGATGTGGATAGTCTCAACCC[FAM-dT]A(THF)[BHQ1-dT] CCGTGTCGTAGCTAAC(C3-Spacer)821–871

Comparison of Chlamydia felis detection in 117 swabs examined by RAA and real-time PCR_

Real-time PCRPerformance characteristics
PositiveNegativeSensitivitySpecificity
RAAPositive20095.24%100%
Negative196
Total2196
DOI: https://doi.org/10.33073/pjm-2023-029 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Journal RSS Feed
Language: English
Page range: 339 - 343
Submitted on: Mar 23, 2023
Accepted on: Jun 30, 2023
Published on: Sep 20, 2023
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
recombinase-aided amplification,
rapid detection
Related subjects:
Life sciences,
Microbiology and virology

© 2023 Jian Liu, Weidong Qian, Jian Wang, Yilan Bai, Yaping Gui, Luming Xia, Guohua Gong, Feifei Ge, Haixiao Shen, Xiaojing Chang, Hongjin Zhao, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 72 (2023): Issue 3 (September 2023)