Table I
Detailed sample information on 59 microbial communities in coals for meta-analysis.
| ID/NCBI accession number | Sites | Primer sequences | Coal rank | Treatment | References |
|---|---|---|---|---|---|
| SRR9312778-SRR9312784 | Erlian Basin | 515F: GTGCCAGCMGCCGCGG 907R: CCGTCAATTCMTTTRAGTTT | Lignite | ck (no treat | (Wang et al. 2019a) |
| SRR6998887 | Moghla | 515F: GTGCCAGCMGCCGCGGTAA 806R: GGACTACHVGGGTWTCTAAT | Bituminous | (Sharma et al. 2019) | |
| SRR1695964 | Queensland | 926F: AAACTYAAAKGAATTGACGG 1392R: ACGGGCGGTGTGTRC | Bituminous | (Raudsepp et al. 2016) | |
| SRR1695967 | |||||
| SRR1695969 | |||||
| SRR1695971 | |||||
| SRR5342611 | Powder River Basin | 341F: CCTACGGGNBGCASCAG 805R: GACTACNVGGGTATCTAATCC | Bituminous | (Davis et al. 2018) | |
| SRR8373697-SRR8373705 | Anhui | 338F: ACTCCTACGGGAGGCAGCAG 806R: GGACTACHVGGGTWTCTAAT | Bituminous | (Liu et al. 2019) | |
| SRR8373722-SRR8373724 | |||||
| SRR8373719-SRR8373721 | Guizhou | Anthracite | |||
| SRR8373696 | Shanxi | Bituminous | |||
| SRR8373718 | |||||
| SRR8373734-SRR8373745 | |||||
| SRR8373746 | Anthracite | ||||
| SRR8373747 | |||||
| SRR7271165 | Huaibei Coalfield | 515F: GTGCCAGCMGCCGCGG 907R: CCGTCAATTCMTTTRAGTTT | Bituminous | nutrients | (Wang et al. 2019b) |
| SRR11128868 | Konin Basin | 341F: CCTACGGGNGGCWGCAG 785R: GACTACHVGGGTATCTAATCC | Lignite | (Bucha et al. 2020) | |
| SRR5826886 | New South Wales | Bituminous | (in 't Zandt et al. 2018) | ||
| SRR5826888 | |||||
| SRR5826889 | |||||
| SRR11241403 | Upper Coal Basin Silesian | Bituminous | (Pytlak et al. 2020) | ||
| SRR5397976 | Konin Basin | 314F: CCTACGGGNGGCWGCAG 805R: GACTACHCGGGTATCTAATCC | Bituminous | (Detman et al. 2018) | |
| SRR7422168 | Jiaozuo | Anthracite | (Su et al. 2018) | ||
| SRR7422169 | Neimeng | Bituminous | |||
| SRR7422170 | Suzhou | Bituminous | |||
| SRR7422171 | Jingcheng | Anthracite | |||
| SRR7422172 | Hebi | Bituminous | |||
| SRR7422173 | Shaqu | Bituminous | |||
| SRR7422174 | Liyazhuang | Bituminous | |||
| SRR7422175 | Yima | Bituminous | |||
| SRR7422176 | Pingdingshan | Bituminous | |||
| SRR7422177 | Shoushan | Bituminous | |||
| SRR5342597 | Powder River Basin | 341F: CCTACGGGNBGCASCAG 805R: GACTACNVGGGTATCTAATCC | Bituminous | (Davis et al. 2018) | |
| SRR5342605 | Bituminous |
Fig. 1
a) Chao1 index and b) Shannon index of the abundant and rare genera in coals. The Wilcoxon test was used to compare the differences in microbial diversities.
Fig. 2
a) Ordering of the abundant community compositions at the genus level by nonmetric multidimensional scaling (NMDS) based on the Bray-Curtis dissimilarity index; b) ordering of the rare community compositions at the genus level by NMDS based on the Bray-Curtis distance index; c) difference for Bray-Curtis dissimilarities among nutrient and ck groups. The Wilcoxon test was used to compare the differences in Bray-Curtis dissimilarities.
Fig. 3
Manhattan plot of the changes in a) abundant and b) rare genera in coals under nutrient stimulation. Detailed information is shown in Tables SII and SIII.
Fig. 4
Heatmap for a) the profuse and b) rare known genera (detected in more than 30% of samples).
Fig. 5
Redundancy analysis (RDA) for coal characteristics (including TC, TN, TO, TH, Vdaf, Ad, and Mad) on the coal microbial compositions.
a) the effect of coal characteristics on profuse microbial compositions in the ck group; b) the effect of coal characteristics on rare microbial compositions in the ck group; c) the effect of coal characteristics on profuse microbial compositions in the nutrient group; d) the effect of coal characteristics on rare microbial compositions in the nutrient group; e) the effect of nutrients on profuse microbial compositions; f) the effect of nutrients on rare microbial compositions.
Fig. 6
Deterministic and stochastic processes in community assembly. a) βNTI index in abundant and rare groups; b) the relative influences of deterministic and stochastic assembly processes in shaping abundant and rare groups. Detailed information is shown in Tables SIV–SVII.
Fig. 7
Co-occurrence networks of abundant and rare groups in coals based on the correlation analysis. Detailed information is shown in Tables SVIII–SXI. Pro – Proteobacteria, Act – Actinobacteria, Bact – Bacteroidetes, Fir – Firmicutes, Ver – Verrucomicrobia, Pla – Planctomycetes, Spi – Spirochaetes, Acido – Acidobacteria, Eury – Euryarchaeota, Cren – Crenarchaeota, Gem – Gemmatimonadetes, Chl – Chloroflexi, and Syn – Synergistetes.