Skip to main content
Have a personal or library account? Click to login
Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris Cover

Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris

Open Access
|Aug 2020

Figures & Tables

Table I

Bacterial strains used in the specificity assessment.

StrainOriginFAMHEX
Proteus mirabilisCVCC4106+
Proteus mirabilisCVCC1969+
Proteus mirabilisATCC35659+
Proteus mirabilisCMCC49001+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus vulgarisATCC6896+
Proteus vulgarisCMCC 49008+
Proteus vulgarisCMCC49027+
Proteus vulgarisCMCC 49105+
Proteus vulgarisIsolated by lab+
Proteus vulgarisIsolated by lab+
Proteus vulgarisIsolated by lab+
Proteus penneriATCC 33519
Proteus penneriNTCC 35198
Providencia rettgeriATCC 31052
Providencia rettgeriCVCC3947
Morganella morganiiATCC9237
Morganella morganiiCICC71786
SalmonellaATCC14028
SalmonellaCVCC2227
SalmonellaIsolated by lab
SalmonellaIsolated by lab
Escherichia coliCICC52719
Escherichia coliIsolated by lab
Escherichia coliIsolated by lab
Staphylococcus aureusATCC25923
Staphylococcus aureusIsolated by lab
Campylobacter jejuniCICC 22936
Campylobacter jejuniIsolated by lab
Mannheimia haemolyticaATCC29695
Pseudomonas aeruginosaIsolated by lab
Lactobacillus acidophilusCICC6074
Bacillus subtilisCICC20445

1 ATCC – American Type Culture Collection; CICC – China Center of Industrial Culture Collection; CMCC – China Medical Culture Collection; CVCC – China Veterinary Culture Collection Center, NTCC – National Type Culture Collection, China

Table II

Primer and TaqMan probe sequences used in this study.

PathogenTarget geneAccession numberPrimer (position)Sequence (5’ → 3’)Amplicon length (bp)
Proteus mirabilisureRCP044134.1  64FACTACCCATCAGATTATGTCAT101
165RCTGTTTGAGGAAAATGCAATTTA
136PFAM-ATTCACACCCTACCCAACATTCAT-BHQ1
Proteus vulgarisblaBD37831.1503FTCGTAAAGAGCCTGAATTAA229
732RATCACCACTACCGGTTTTATC
532PHEX-TCATGGTGATCCTCGTGATACTA-BHQ1
Fig. 1.

P. mirabilis standard curve (Note: log = 1og10).

Fig. 2.

P. vulgaris standard curve (Note: log = 1og10).

Fig. 3.

Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.

Fig. 4.

Detection limits of P. mirabilis and P. vulgaris in contaminated pork.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Fig. 5.

Detection limits of P. mirabilis and P. vulgaris in contaminated milk.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

DOI: https://doi.org/10.33073/pjm-2020-032 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 293 - 300
Submitted on: May 3, 2020
Accepted on: Jul 8, 2020
Published on: Aug 25, 2020
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 RUI YANG, GUOYANG XU, XIAOYOU WANG, ZHICHU QING, LIZHI FU, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.