Have a personal or library account? Click to login
Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris Cover

Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris

Polish Journal of Microbiology
Volume 69 (2020): Issue 3 (September 2020)
By: RUI YANG,  GUOYANG XU,  XIAOYOU WANG,  ZHICHU QING and  LIZHI FU  
Open Access
|Aug 2020

Figures & Tables

Fig. 1.

P. mirabilis standard curve (Note: log = 1og10).
P. mirabilis standard curve (Note: log = 1og10).

Fig. 2.

P. vulgaris standard curve (Note: log = 1og10).
P. vulgaris standard curve (Note: log = 1og10).

Fig. 3.

Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.
Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.

Fig. 4.

Detection limits of P. mirabilis and P. vulgaris in contaminated pork.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.
Detection limits of P. mirabilis and P. vulgaris in contaminated pork.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Fig. 5.

Detection limits of P. mirabilis and P. vulgaris in contaminated milk.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.
Detection limits of P. mirabilis and P. vulgaris in contaminated milk.The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Bacterial strains used in the specificity assessment_

StrainOriginFAMHEX
Proteus mirabilisCVCC4106+−
Proteus mirabilisCVCC1969+−
Proteus mirabilisATCC35659+−
Proteus mirabilisCMCC49001+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus mirabilisIsolated by lab+−
Proteus vulgarisATCC6896−+
Proteus vulgarisCMCC 49008−+
Proteus vulgarisCMCC49027−+
Proteus vulgarisCMCC 49105−+
Proteus vulgarisIsolated by lab−+
Proteus vulgarisIsolated by lab−+
Proteus vulgarisIsolated by lab−+
Proteus penneriATCC 33519−−
Proteus penneriNTCC 35198−−
Providencia rettgeriATCC 31052−−
Providencia rettgeriCVCC3947−−
Morganella morganiiATCC9237−−
Morganella morganiiCICC71786−−
SalmonellaATCC14028−−
SalmonellaCVCC2227−−
SalmonellaIsolated by lab−−
SalmonellaIsolated by lab−−
Escherichia coliCICC52719−−
Escherichia coliIsolated by lab−−
Escherichia coliIsolated by lab−−
Staphylococcus aureusATCC25923−−
Staphylococcus aureusIsolated by lab−−
Campylobacter jejuniCICC 22936−−
Campylobacter jejuniIsolated by lab−−
Mannheimia haemolyticaATCC29695−−
Pseudomonas aeruginosaIsolated by lab−−
Lactobacillus acidophilusCICC6074−−
Bacillus subtilisCICC20445−−

Primer and TaqMan probe sequences used in this study_

PathogenTarget geneAccession numberPrimer (position)Sequence (5’ → 3’)Amplicon length (bp)
Proteus mirabilisureRCP044134.1  64FACTACCCATCAGATTATGTCAT101
165RCTGTTTGAGGAAAATGCAATTTA
136PFAM-ATTCACACCCTACCCAACATTCAT-BHQ1
Proteus vulgarisblaBD37831.1503FTCGTAAAGAGCCTGAATTAA229
732RATCACCACTACCGGTTTTATC
532PHEX-TCATGGTGATCCTCGTGATACTA-BHQ1
DOI: https://doi.org/10.33073/pjm-2020-032 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Journal RSS Feed
Language: English
Page range: 293 - 300
Submitted on: May 3, 2020
Accepted on: Jul 8, 2020
Published on: Aug 25, 2020
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
TaqMan Real-Time PCR,
food-borne pathogens,
food poisoning
Related subjects:
Life sciences,
Microbiology and virology

© 2020 RUI YANG, GUOYANG XU, XIAOYOU WANG, ZHICHU QING, LIZHI FU, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 69 (2020): Issue 3 (September 2020)Next article