Skip to main content
Have a personal or library account? Click to login
PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains Cover

PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains

Open Access
|May 2020

Figures & Tables

Fig. 1.

Neighbor-joining tree based on 16S rRNA gene sequences of closely related type strains. Evolutionary distance was calculated using Kimura 2-parameters with 1000 bootstrap value.

Fig. 2.

Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains tested (Fusarium oxysporum (FO), Rhizoctonia solani (RS), and Aspergillus sp. (FN2). (A), (B), (C) Anti fungal activity of NR-1, NR-10, and NR-15 by the agar plug method against Fusarium oxysporum (FO), Rhizoctonia solani (RS). (D), (E), (F) Activity of NR-1, NR-14, and NR-15 by the agar plug method against Aspergillus sp. (FN2). (G), (H), (I) Activity of NR-1, NR-14, NR-10, H26, and CHX (cycloheximide) by the well diffusion method against Aspergillus sp.

Fig. 3.

Chemical profile of the selected Actinomycetes strains. (A) TLC plate at 366 nm. (B) TLC plate after spraying with Ehrlich’s reagent. (C) TLC plate after spraying with anisaldehyde reagent.

Fig 4.

HPLC analysis of crude extracts of the polyene producing Streptomyces sp. (A) HPLC chromatogram of strain NR-1, (B) HPLC chromatogram of strain NR-10, (C) HPLC chromatogram of strain NR-14, (D) HPLC chromatogram of strain NR-15.

Fig. 5.

The relative abundance of the nrps, pks-1, cyps, oxy b genes in the selected Streptomyces strains.

Antifungal activity of the selected polyene producing Streptomyces sp_ against different fungal strains (Fusarium oxysporum, Rhizoctonia solani, and Aspergillus sp_)_

The fungus strain testedZone of inhibition in mm
NR-1NR-10NR-14NR-15MM7CHX
Fusarium oxysporum 17.0 ± 0.1117.8 ± 0.1814.7 ± 0.2216.0 ± 0.255.1 ± 0.121  9.9 ± 0.26
Rhizoctonia solani 18.0 ± 0.3212.2 ± 0.4113.8 ± 0.4516.6 ± 0.450.2 ± 0.11  10.9 ± 0.53
Aspergillus sp.22.1 ± 0.4019.0 ± 0.1218.8 ± 0.2718.3 ± 0.381.7 ± 0.42  14.0 ± 0.18

PCR primers for the nrps, pks-1, cyps, and oxy b genes_

GenesPrimersSequence (5’-3’)LengthTmProduct sizeReferences
cyps CYP-FTGGATCGGCGACGACCGSVYCGT23 bp63.8350 bpAyuso-Sacido and Genilloud 2005
CYP-RCCGWASAGSAYSCCGTCGTACTT23 bp56.6
oxy b GLY-FCTGGTCGGCAACCTGATGGAC21 bp61.7560 bpAyuso-Sacido and Genilloud 2005
GLY-RCAGGTACCGGATCAGCTCGTC21 bp61.7
pks1 K1FTSAAGTCSAACATCGGBCA19 bp48.41200–1500 bpAyuso-Sacido and Genilloud 2005
M6RCGCAGGTTSCSGTACCAGTA20 bp55.4
nrps A3FGCSTACSYSATSTACACSTCSGG23 bp53.1700 bpWood et al 2007
A7RSASGTCVCCSGTSCGGTAS19 bp50.6

Streptomyces sp_ GenBank accession numbers of 16S rRNA genes_

S. No. Given Code of StrainGenBank Accession No.Identified as
NR-1MK243371 Streptomyces sp.
NR-10MK243372 Streptomyces sp.
NR14MK243373 Streptomyces sp.
NR15MK243374 Streptomyces sp.
NR11MN912434 Streptomyces sp.
C2MN912435 Streptomyces pseudovenezuelae
D6-3MN912436 Streptomyces flavogriseus
H34AMN912437 Streptomyces sp.
H34BMN912438 Streptomyces sp.
NR28MN912439 Streptomyces flavoviridis
NR1MN912440 Streptomyces sp.
NR5MN912441 Streptomyces werraensis
10MMN912442 Streptomyces sp.
C3MN912443 Streptomyces fenghuangensis
H32BMN912444 Streptomyces sp.
B5KMN912445 Streptomyces fimbriatus
H31AMN912446 Nocardioides sp.
M19MN912447 Streptomyces albogriseolus
MM5MN912448 Streptomyces Streptomyces griseus
NR3MN912449 Streptomyces sp.
M63MN912450 Streptomyces misionensis
M32MN912451 Streptomyces sp.
M12MN912452 Streptomyces steffisburgensis.
MM7MN912453 Streptomyces fimbriatus.
M13MN912454 Streptomyces niveoruber
D3-1MN912455 Streptomyces bambusae
M29MN912456 Streptomyces sp.
M28MN912457 Streptomyces coerulescens
NR24MN912458 Streptomyces silaceus
NR22MN912459 Streptomyces sp.
H26MN912460 Streptomyces steffisburgensis
M43MN912461 Streptomyces rubrolavendulae
NR12MN912462 Streptomyces neopeptinius
NR6MN912463 Streptomyces coeruleoprunus
D3-3MN912464 Streptomyces sp.
D3-2MN912465 Streptomyces sp.
M93KM062032 Streptomyces laurentii
M71KM062033 Streptomyces vitaminophilus
M54KM062034 Streptomyces hypolithicus
M51KM062035 Streptomyces chartreusis

Streptomyces sp_ GenBank accession numbers of the genes sequences_

S. No.IsolatesNucleotide lengthGenBank Accession No.% age homologyGenes encoding for
1.NR-1  350 bp  98CYPMF279145
2.NR-10  350 bp100CYPMF279146
3.NR14  350 bp  98CYPMK272790
4.NR15  350 bp  98CYPMK272791
5.NR-16  700 bp100NRPSMF279147
6.M13  700 bp  99NRPSMF279148
7.NR-12  700 bp  98NRPSMF279150
8.NR-6  1500 bp  98PKS-1MF279149

The translated DNA sequence of NR-1 based on six reading frames and their percentage similarity with cytochrome P450 hydroxylase (CYP) protein_

Sequence translation (EMBOSS Transq)% similarity with cytochrome P450 hydroxylase protein
EMBOSS_001_198
EMBOSS_001_250
EMBOSS_001_3No significant similarity found
EMBOSS_001_445
EMBOSS_001_5No significant similarity found
EMBOSS_001_6No significant similarity found
DOI: https://doi.org/10.33073/pjm-2020-016 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 139 - 149
Submitted on: Nov 29, 2019
Accepted on: Mar 29, 2020
Published on: May 12, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 NAILA NOUREEN, MOHSIN TASSAWAR CHEEMA, SUMAIRA ANWAR, SHAHIDA HASNAIN, IMRAN SAJID, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.