Table I
PCR primers for the nrps, pks-1, cyps, and oxy b genes.
| Genes | Primers | Sequence (5’-3’) | Length | Tm | Product size | References |
|---|---|---|---|---|---|---|
| cyps | CYP-F | TGGATCGGCGACGACCGSVYCGT | 23 bp | 63.8 | 350 bp | Ayuso-Sacido and Genilloud 2005 |
| CYP-R | CCGWASAGSAYSCCGTCGTACTT | 23 bp | 56.6 | |||
| oxy b | GLY-F | CTGGTCGGCAACCTGATGGAC | 21 bp | 61.7 | 560 bp | Ayuso-Sacido and Genilloud 2005 |
| GLY-R | CAGGTACCGGATCAGCTCGTC | 21 bp | 61.7 | |||
| pks1 | K1F | TSAAGTCSAACATCGGBCA | 19 bp | 48.4 | 1200–1500 bp | Ayuso-Sacido and Genilloud 2005 |
| M6R | CGCAGGTTSCSGTACCAGTA | 20 bp | 55.4 | |||
| nrps | A3F | GCSTACSYSATSTACACSTCSGG | 23 bp | 53.1 | 700 bp | Wood et al 2007 |
| A7R | SASGTCVCCSGTSCGGTAS | 19 bp | 50.6 |
Fig. 1.
Neighbor-joining tree based on 16S rRNA gene sequences of closely related type strains. Evolutionary distance was calculated using Kimura 2-parameters with 1000 bootstrap value.
Table II
Streptomyces sp. GenBank accession numbers of 16S rRNA genes.
| S. No. Given Code of Strain | GenBank Accession No. | Identified as |
|---|---|---|
| NR-1 | MK243371 | Streptomyces sp. |
| NR-10 | MK243372 | Streptomyces sp. |
| NR14 | MK243373 | Streptomyces sp. |
| NR15 | MK243374 | Streptomyces sp. |
| NR11 | MN912434 | Streptomyces sp. |
| C2 | MN912435 | Streptomyces pseudovenezuelae |
| D6-3 | MN912436 | Streptomyces flavogriseus |
| H34A | MN912437 | Streptomyces sp. |
| H34B | MN912438 | Streptomyces sp. |
| NR28 | MN912439 | Streptomyces flavoviridis |
| NR1 | MN912440 | Streptomyces sp. |
| NR5 | MN912441 | Streptomyces werraensis |
| 10M | MN912442 | Streptomyces sp. |
| C3 | MN912443 | Streptomyces fenghuangensis |
| H32B | MN912444 | Streptomyces sp. |
| B5K | MN912445 | Streptomyces fimbriatus |
| H31A | MN912446 | Nocardioides sp. |
| M19 | MN912447 | Streptomyces albogriseolus |
| MM5 | MN912448 | Streptomyces Streptomyces griseus |
| NR3 | MN912449 | Streptomyces sp. |
| M63 | MN912450 | Streptomyces misionensis |
| M32 | MN912451 | Streptomyces sp. |
| M12 | MN912452 | Streptomyces steffisburgensis. |
| MM7 | MN912453 | Streptomyces fimbriatus. |
| M13 | MN912454 | Streptomyces niveoruber |
| D3-1 | MN912455 | Streptomyces bambusae |
| M29 | MN912456 | Streptomyces sp. |
| M28 | MN912457 | Streptomyces coerulescens |
| NR24 | MN912458 | Streptomyces silaceus |
| NR22 | MN912459 | Streptomyces sp. |
| H26 | MN912460 | Streptomyces steffisburgensis |
| M43 | MN912461 | Streptomyces rubrolavendulae |
| NR12 | MN912462 | Streptomyces neopeptinius |
| NR6 | MN912463 | Streptomyces coeruleoprunus |
| D3-3 | MN912464 | Streptomyces sp. |
| D3-2 | MN912465 | Streptomyces sp. |
| M93 | KM062032 | Streptomyces laurentii |
| M71 | KM062033 | Streptomyces vitaminophilus |
| M54 | KM062034 | Streptomyces hypolithicus |
| M51 | KM062035 | Streptomyces chartreusis |
Table III
Streptomyces sp. GenBank accession numbers of the genes sequences.
| S. No. | Isolates | Nucleotide length | GenBank Accession No. | % age homology | Genes encoding for |
|---|---|---|---|---|---|
| 1. | NR-1 | 350 bp | 98 | CYP | MF279145 |
| 2. | NR-10 | 350 bp | 100 | CYP | MF279146 |
| 3. | NR14 | 350 bp | 98 | CYP | MK272790 |
| 4. | NR15 | 350 bp | 98 | CYP | MK272791 |
| 5. | NR-16 | 700 bp | 100 | NRPS | MF279147 |
| 6. | M13 | 700 bp | 99 | NRPS | MF279148 |
| 7. | NR-12 | 700 bp | 98 | NRPS | MF279150 |
| 8. | NR-6 | 1500 bp | 98 | PKS-1 | MF279149 |
Table IV
The translated DNA sequence of NR-1 based on six reading frames and their percentage similarity with cytochrome P450 hydroxylase (CYP) protein.
| Sequence translation (EMBOSS Transq) | % similarity with cytochrome P450 hydroxylase protein |
|---|---|
| EMBOSS_001_1 | 98 |
| EMBOSS_001_2 | 50 |
| EMBOSS_001_3 | No significant similarity found |
| EMBOSS_001_4 | 45 |
| EMBOSS_001_5 | No significant similarity found |
| EMBOSS_001_6 | No significant similarity found |
Table V
Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains (Fusarium oxysporum, Rhizoctonia solani, and Aspergillus sp.).
| The fungus strain tested | Zone of inhibition in mm | |||||
|---|---|---|---|---|---|---|
| NR-1 | NR-10 | NR-14 | NR-15 | MM7 | CHX | |
| Fusarium oxysporum | 17.0 ± 0.11 | 17.8 ± 0.18 | 14.7 ± 0.22 | 16.0 ± 0.25 | 5.1 ± 0.121 | 9.9 ± 0.26 |
| Rhizoctonia solani | 18.0 ± 0.32 | 12.2 ± 0.41 | 13.8 ± 0.45 | 16.6 ± 0.45 | 0.2 ± 0.11 | 10.9 ± 0.53 |
| Aspergillus sp. | 22.1 ± 0.40 | 19.0 ± 0.12 | 18.8 ± 0.27 | 18.3 ± 0.38 | 1.7 ± 0.42 | 14.0 ± 0.18 |
Fig. 2.
Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains tested (Fusarium oxysporum (FO), Rhizoctonia solani (RS), and Aspergillus sp. (FN2). (A), (B), (C) Anti fungal activity of NR-1, NR-10, and NR-15 by the agar plug method against Fusarium oxysporum (FO), Rhizoctonia solani (RS). (D), (E), (F) Activity of NR-1, NR-14, and NR-15 by the agar plug method against Aspergillus sp. (FN2). (G), (H), (I) Activity of NR-1, NR-14, NR-10, H26, and CHX (cycloheximide) by the well diffusion method against Aspergillus sp.
Fig. 3.
Chemical profile of the selected Actinomycetes strains. (A) TLC plate at 366 nm. (B) TLC plate after spraying with Ehrlich’s reagent. (C) TLC plate after spraying with anisaldehyde reagent.
Fig 4.
HPLC analysis of crude extracts of the polyene producing Streptomyces sp. (A) HPLC chromatogram of strain NR-1, (B) HPLC chromatogram of strain NR-10, (C) HPLC chromatogram of strain NR-14, (D) HPLC chromatogram of strain NR-15.
Fig. 5.
The relative abundance of the nrps, pks-1, cyps, oxy b genes in the selected Streptomyces strains.