Have a personal or library account? Click to login
Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq Cover

Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq

Polish Journal of Microbiology
Volume 69 (2020): Issue 1 (March 2020)
By: EMAN DHAHIR ARIF,  NAHLA MUHAMMAD SAEED and  SHWAN KAMAL RACHID  
Open Access
|Feb 2020

Figures & Tables

Fig. 1.

Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.
Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.

Fig. 2.

Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.
Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.

Fig. 3.

Phylogenic trees based on the ompA gene showed that the Sul/2017 chlamydia from Iraq belonged to C. abortus and revealed that Sul/2017 has a common ancestor, respectively. The partial ompA gene of Sul/2017 has been compared with 75 sequences of Chlamydia species that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). The tree shows that Sul/2017 has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243 and with Sul/2014, CAAB7, H and Krauss-15 isolates that were in a group 2 of Chlamydia abortus.
Phylogenic trees based on the ompA gene showed that the Sul/2017 chlamydia from Iraq belonged to C. abortus and revealed that Sul/2017 has a common ancestor, respectively. The partial ompA gene of Sul/2017 has been compared with 75 sequences of Chlamydia species that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). The tree shows that Sul/2017 has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243 and with Sul/2014, CAAB7, H and Krauss-15 isolates that were in a group 2 of Chlamydia abortus.

Detection of Chlamydia abortus and Brucella abortus in different herds of sheep from three districts in Sulaimani province by PCR_

Name of districtNumber of samples collectedNumber positive for C. abortus (%)Number positive for B. abortus (%)
Kalar151 (6.66)14 (93.33)
Said Sadiq10010 (100)
Chamchamal505(100)
Total301 (3.33)29 (96.66)

The targeted genes and PCR primers used for the detection of Chlamydia abortus and Brucella abortus in aborted ewes_

Target genePrimer namePrimer sequence (5′–3′)Amplified fragment length (bp)Reference
ompA omp-FATGAAAAAACTCTTGAAATCGG1058Arshi et al. 2011
omp-RCAAGATTTTCTAGACTTCATTTTGTT
bcsp31 B4-FTGGCTCGGTTGCCAATATCAA223 Baily et al. 1992
B5-RCGCGCTTGCCTTTCAGGTCTG
DOI: https://doi.org/10.33073/pjm-2020-009 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Journal RSS Feed
Language: English
Page range: 65 - 71
Submitted on: Dec 11, 2019
|
Accepted on: Jan 30, 2020
|
Published on: Feb 28, 2020
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
enzootic abortion in ewes,
embryonated egg,
polymerase chain reaction
Related subjects:
Life sciences,
Microbiology and virology

© 2020 EMAN DHAHIR ARIF, NAHLA MUHAMMAD SAEED, SHWAN KAMAL RACHID, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 69 (2020): Issue 1 (March 2020)Next article