Have a personal or library account? Click to login
Determination of genetic diversity between natural and cultured populations of Common Dentex (Dentex dentex) fish in the East Aegean Sea Cover

Determination of genetic diversity between natural and cultured populations of Common Dentex (Dentex dentex) fish in the East Aegean Sea

Open Access
|Mar 2023

Figures & Tables

Figure 1

Six different locations where fish samples were obtained
Six different locations where fish samples were obtained

Figure 2

Some pictures of the common dentex samples obtained from the locations
Some pictures of the common dentex samples obtained from the locations

Figure 3

Sample coding system used in the present study
Sample coding system used in the present study

Figure 4

On the left axis is the Cycle number (Ct, orange line) and on the right axis is the melting temperature (Tm, blue line) data of the QPCR experiments for the COI target gene of the D. dentex samples collected from different locations.
On the left axis is the Cycle number (Ct, orange line) and on the right axis is the melting temperature (Tm, blue line) data of the QPCR experiments for the COI target gene of the D. dentex samples collected from different locations.

Figure 5

Median Joining network to sample haplotypes and representation of haplogroups of Common Dentex
Median Joining network to sample haplotypes and representation of haplogroups of Common Dentex

Figure 6

Phylogenetic reconstruction of 53 Common Dentex COI sequences grouped with respect to locations using Nei’s Dxy distance matrix. W: wild, C: culture.
Phylogenetic reconstruction of 53 Common Dentex COI sequences grouped with respect to locations using Nei’s Dxy distance matrix. W: wild, C: culture.

Figure 8

The cladogram NJ tree created with the Treeview obtained according to Wright’s F statistic for the common dentex samples at the stations in the study. W: wild, C: culture.
The cladogram NJ tree created with the Treeview obtained according to Wright’s F statistic for the common dentex samples at the stations in the study. W: wild, C: culture.

Figure 7

The cladogram NJ tree created with the Treeview obtained according to Wright’s F statistic for the common dentex samples at the stations in the study. W: wild, C: culture.
The cladogram NJ tree created with the Treeview obtained according to Wright’s F statistic for the common dentex samples at the stations in the study. W: wild, C: culture.

Haplotype structure of D_ dentex samples with respect to nucleotide variation in the COI region

Nucleotide positions in COI region
Haplotype NumberFrequency1920374754658098111126129131150165171192238247284342398399406407441447455
H 125TAGAATACTTAACTTGTAAACTTCTTG
H 21..A........................
H 31.............C.......C.....
H 41.........C.............T.C.
H 51.......ACC.................
H 61G..C..C....................
H 71GCAC.......................
H 81GCA................T.......
H 92.....G.....................
H 101GCA..G........C............
H 111GCAC.G.....................
H 121GCA..G.....................
H 131GCA.GG............C........
H 141.....................C.....
H 152G..........................
H 162...............A...........
H 171G.A..G................G....
H 181....................T......
H 191................C..........
H 201............A..............
H 211.......A.........C....G....
H 221GCA........................
H 231.......A..............G....
H 241...........C...............
H 251...............A........A.C
H 261..........C................

Sampling locations of common dentex and number of the samples per location

No.Sampling LocationSample CodeNumber of samples
1Karaburun- NaturalI-W9
2Karaburun- CultureI-C9
3Çeşme-NaturalII-W5
4Kuşadası-NaturalIII-W10
5Güllük-NaturalIV-W5
6Bodrum-NaturalV-W4
7Çanakkale-NaturalVI-W6
8Antalya-NaturalVII-W5
TOTAL53

Haplotype groups and sample codes in the same haplotype group

HaplotypesSample Code
H 1I-W-D.dentex-1, I-W-D.dentex-2, I-W-D.dentex-3, I-W-D.dentex-7, I-W-D.dentex-8, I-W-D.dentex-9, I-W-D.dentex-10, I-C-D.dentex-9, II-W-D.dentex-4, II-W-D.dentex-5, III-W-D. dentex-2, III-W-D.dentex-4, III-W-D.dentex-8, III-W-D.dentex-9, III-W-D.dentex-10, IV-W-D.dentex-2, IV-W-D.dentex-4, IV-W-D.dentex-5, IV-W-D.dentex-6, V-W-D.dentex-2, V-W-D. dentex-4, VI-W-D.dentex-2, VI-W-D.dentex-4, VI-W-D.dentex-5, VII-W-D.dentex-5
H 2I-W-D.dentex-4H 15III-W-D.dentex-1, III-W-D.dentex-5
H 3I-W-D.dentex-5H 16III-W-D.dentex-3, VI-W-D.dentex-3
H 4I-C-D.dentex-1H 17III-W-D.dentex-6
H 5I-C-D.dentex-2H 18III-W-D.dentex-7
H 6I-C-D.dentex-3H 19V-W-D.dentex-1
H 7I-C-D.dentex-4H 20V-W-D.dentex-3
H 8I-C-D.dentex-5H 21VI-W-D.dentex-1
H 9I-C-D.dentex-7, IV-W-D.dentex-1H 22VI-W-D.dentex-6
H 10I-C-D.dentex-8H 23VII-W-D.dentex-1
H 11I-C-D.dentex-10H 24VII-W-D.dentex-2
H 12II-W-D.dentex-1H 25VII-W-D.dentex-3
H 13II-W-D.dentex-2H 26VII-W-D.dentex-4
H 14II-W-D.dentex-3

Genetic diversity and neutrality tests of the D_dentex populations with respect to locations

PopulationSample size (n)N Haplotype numberHaplotype Diversity (h)PSPIRNucleotide diversity (π)Taijm’a’s DFu’s Fs
I-C. D.dentex991.0006130.0097(± 0.0012)−1.513−0.380
I-W. D.dentex930.417470.0014 (± 0.0007)−0.176−5.174**
II-W. D.dentex540.900160.0076 (± 0.0022)0.498−0.036
III-W. D.dentex1050.756010.0031 (± 0.0005)−1.276−1.320
IV-W. D.dentex520.400020.0008 (± 0.0007)−0.8170.090
V-W. D.dentex430.833070.0021 (± 0.0007)−0.710−0.887
VI-W. D.dentex640.800070.0049 (± 0.0014)−1.390*−0.219
VII-W. D.dentex551.000030.0059 (± 0.0014)−1.162−2.371*

Genetic distance calculation of D_ dentex populations with respect to where the stations’ samples were collected from (Nei’s dxy and Da method)

Da
I-CI-WII-WIII-WIV-WV-WVI-WVII-W
Dxy*
Karaburun I-C00.00148−0.000450.000800.001410.001690.000600.00160
Karaburun I-W0.0070100.000560.000090.000000.00000−0.000080.00000
Çeşme II-W0.008150.0050300.000140.000500.000840.000000.00084
Kuşadası III-W0.007170.002330.0054500.000060.00014−0.00028−0.00004
Güllük IV-W0.006660.001120.004700.0020100.000000.000000.00000
Bodrum V-W0.007570.001750.005660.002730.0014700.000000.00000
Çanakkale VI-W0.007880.003070.006220.003700.002870.003490−0.00042
Antalya VII-W0.009360.003630.007550.004440.003350.003980.004960

Distance matrix obtained according to Wright’s F statistics for the Common Dentex (Dentex dentex) sample at the stations in the study

I-CI-WII-WIII-WIV-WV- WVI-WVII-W
Karaburun I-C0.00000
Karaburun I-W0.22466*0.00000
Çeşme II-W0.085220.000770.00000
Kuşadası III-W0.037160.07255−0.025640.00000
Güllük IV-W−0.082570.166670.044120.004740.00000
Bodrum V-W0.21178−0.02273−0.032610.040850.166670.00000
Çanakkale VI-W0.032260.01562−0.08541−0.05174−0.00737−0.023620.00000
Antalya VII-W0.024630.04000−0.06047−0.05882−0.012050.00415−0.087110.00000

Map coordinates of the stations where common dentex samples were obtained

StationsCommon Dentex NaturalCommon Dentex Culture
(I) KaraburunFoça offshore38°48′34.8″N26°38′09.4″EAkvatur Fish Farm38°30′29.3″N26°23′12.4″E
(II) Çeşme*Çeşme fish pond38°22′07.1″N26°19′39.6″E
(III) Kuşadası**Çağlar fishery agency37°48′51.1″N27°08′58.4″E
(IV) GüllükGüllük Gulf37°14′25.0″N27°35′32.8″E
(V) BodrumBodrum Şenol Fishery37°02′08.2″N27°25′54.7″E
(VI) ÇanakkaleEngin Fishery40°08′38.5″N26°24′19.6″E
(VII) AntalyaAntalya offshore36°50′4.98″N30°38′47.14″E
DOI: https://doi.org/10.26881/oahs-2023.1.04 | Journal eISSN: 1897-3191 | Journal ISSN: 1730-413X
Language: English
Page range: 52 - 67
Submitted on: Dec 2, 2022
Accepted on: Dec 21, 2022
Published on: Mar 18, 2023
Published by: University of Gdańsk
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Ali Kayaci, Mehmet Fatih Can, Yusuf Güner, Fatih Güleç, published by University of Gdańsk
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.