Skip to main content
Have a personal or library account? Click to login
Occurrence of Serratia marcescens in bovine intramammary infections: identification and antimicrobial susceptibility in a dairy herd Cover

Occurrence of Serratia marcescens in bovine intramammary infections: identification and antimicrobial susceptibility in a dairy herd

Open Access
|Aug 2026

Figures & Tables

Table 1.

Primer sequences used for molecular characterisation of bacterial isolates from dairy-cow quarter milk

GeneForward primerReverse primerExpected product length (bp)
16S rRNAAGGGAGCTTGCCTTGGATTCGGATGCAGTTCCCAGGTTGA557
dinB1CGCTGCACATCCGTGAAATCTGCGCCAAATCGTATTGCTG382
dinB2GATCGCTCAGGAGATCCGTCCCAGCTCGGGGTAGAGTTTG452
rpoBTTGTTTCTGTTGCTGCGTCGGATTTCCTCTGGGCCAAGCT572
Table 2.

Microorganisms identified during the individual stages of microbiological analysis of dairy-cow quarter-milk samples

Month and yearSamples (n)Cows (n)Serratia sp.CNSCPSMRSAStreptococcus sp.Enterococcus sp.Enterobacterales other than SerratiaMicrococcus sp.Bacillus sp.Aerococcus viridansCandida sp.No growthContamination
Feb 2024343413001320000287
Mar 2024353501001300000199
Apr 202456551200410100061
May 20244544150019111000106
Oct 202454521700300010093
Nov 20244746121017120001106
Feb 202535240110913200089
Mar 2025535227118251002197
Apr 2025443724009210010184
May 2025444001200925001096
Jun 2025343213008251000122

[i] CNS – coagulase-negative staphylococci; CPS – coagulase-positive staphylococci; MRSA – methicillin-resistant Staphylococcus aureus

Table 3.

Minimum inhibitory concentrations against Serratia marcescens isolates and antibiograms of those isolates from dairy-cow quarter-milk samples

Antimicrobial agentIsolate 1 (Feb 2024)Isolate 2 (Apr 2024)Isolate 3 (May 2024)Isolate 4 (Oct 2024)Isolate 5 (Nov 2024)Isolate 6 (Mar 2025)Isolate 7 (Mar 2025)Isolate 8 (Apr 2025)Isolate 9 (Apr 2025)Isolate 10 (Jun 2025)
Amikacin≤2 S≤2 S8 S8 S8 S8 S8 S8 S4 S4 S
Amoxicillin/clavulanic acid16 R8 R16 R16 R16 R16 R16 R16 R16 R16 R
Cefepime≤0.12 S≤0.12 S2 I2 I2 I1 S1 S1 S1 S1 S
Cefotaxime≤0.25 S≤0.25 S8 R8 R8 R8 R4 R4 R4 R4 R
Ceftazidime0.25 S0.25 S≥64 R≥64 R≥64 R≥64 R≥64 R16 R32 R16 R
Cefuroxime32 R16 R≥64 R≥64 R≥64 R≥64 R≥64 R32 R32 R32 R
Ciprofloxacin≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S≤0.25 S
Colistin≤16 R≤16 R≤16 R≤16 R≤16 R≤16 R≤16 R≤16 R≤16 R≤16 R
Gentamicin≤1 S≤1 S2 S2 S2 S2 S2 S≤1 S≤1 S≤1 S
Meropenem≤0.25 S≤0.25 S4 I4 I4 I4 I4 I8 S4 I4 I
Piperacillin/tazobactam≤4 S≤4 S64 R64 R≤4 S≤4 S≤4 S≤4 S≤4 S≤4 S
Tigecycline1 R1 R2 R2 R1 R1 R1 R2 R2 R2 R
Tobramycin2 S≤1 S8 R8 R8 R8 R8 R4 R4 R4 R
Trimethoprim/sulfamethoxazole≤20 S≤20 S≤20 S≤20 S≤20 S≤20 S≤20 S≤20 S≤20 S≤20 S

[i] R – resistant; S – susceptible; I – intermediate

Table 4.

Basic local alignment search tool results for molecular identification of bacterial isolates from dairy-cow quarter-milk samples

SequenceQuery coveragePercent identitAccession lengthTaxonAccession No.
rpoB95%97.59%5144137Serratia marcescensCP090244.1
dinB1100%99.71%4962287Serratia marcescensCP132290.1
dinB296%98.74%4962287Serratia marcescensCP132290.1
16S rRNA97%88.30%1220Serratia marcescensMH001477.1
DOI: https://doi.org/10.2478/jvetres-2026-0049 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Submitted on: Feb 17, 2026
Accepted on: Aug 21, 2026
Published on: Aug 27, 2026
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2026 Małgorzata Targońska-Karasek, Wojciech Ospałek, Henryk Krukowski, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.