Skip to main content
Have a personal or library account? Click to login
Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax) Cover

Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Open Access
|Apr 2026

Figures & Tables

Fig. 1.

Partial sequence of polymorphisms in the lep gene of Dicentrarchus labrax. (a) g.11005646A>C; (b) g.11004767C>T; (c) g.11005020T>C>G. Chromatograms were generated from the reverse sequence

Fig. 2.

Linkage disequilibrium plot of the Dicentrarchus labrax lep gene. The values represent r2 × 100

Fig.3.

ConSurf database analysis of the leptin isoform X1 protein of Dicentrarchus labrax

Fig.4.

Structural comparison of wild-type and mutant leptin isoform X1. The conservation analysis of the leptin isoform X1 protein predicted that the arginine amino acid located at position 159, which is marked, is not in an evolutionarily conserved region

Descriptive statistics for production traits

TraitsMinMaxMean (SD)CV (%)
TW (g)171.05863.60459.35 (156.97)34
FW (g)81.11417.44243.68 (82.99)34
SL (cm)21.3836.4729.41 (3.46)12
BL (cm)15.4527.4721.54 (2.55)12
HL (cm)5.2118.878.10 (1.56)19
PecAL (cm)10.9426.9121.19 (2.92)14
AL (cm)7.6717.7313.59 (1.91)14
PostAL (cm)4.5511.639.13 (1.22)13
HH (cm)3.656.885.05 (0.72)14
BH (cm)5.1710.027.45 (1.04)14

Genetic diversity parameters based on single-nucleotide polymorphisms in the Dicentrarchus labrax lep gene

LocusNumber of samplesMAFHeHoPICHWE
11004714G>AGG: 252GA: 140AA: 80.1950.3140.3500.2650.021*
11004767C>TCC: 124CT: 2760.3450.4520.6900.3500.000*
11004804G>AGG: 200GA: 192AA: 80.2600.3850.4800.3110.000*
11005304A>GAA: 208AG: 1920.2400.3650.4800.2980.000*
11005335G>AGG: 292GA: 84AA: 240.1650.2760.2100.2380.000*

Primers used to amplify 1,655 base pairs of the Dicentrarchus labrax lep gene sequence

Gene regionPrimer sequence (5′–3′)AnnealingSequenced regions of lep gene of Dicentrarchus labraxLength
Lep-1F: GTTGGTTAGAGGGAGCTGTR: ACCATTGTCTCAGCTCACCA59°CExon 1 and partial region of intron 1849 bp
Lep-2F: CAGGGGGAGAATGCAAAGTR: CATTCAGTTCAGTTCCCCGT61°CPartial region of intron 1, exon 2, intron 2 and exon 3856 bp

Associations between the lep genotypes and the growth traits of Dicentrarchus labrax

TraitLocusGenotypeP-value
GGGAAA
TW (g)g.11004714 G>A433.72 ±19.60ab513.35 ±25.37a359.98 ±19.11b0.033
FW (g)g.11004714 G>A229.57 ± 10.34ab273.60 ±13.39a187.70 ±7.58b0.024
SL (cm)g.11004714 G>A28.67 ±0.43ab30.44 ± 0.55a26.80 ±2.40b0.027
BL (cm)g.11004714 G>A21.10 ±0.34ab22.40 ±0.40a19.34 ±1.75b0.022
PostAL (cm)g.11004714 G>A8.95 ±0.15ab9.54 ±0.19a8.23 ±0.81b0.027
g.11004804 G>A8.84 ±0.16ab9.50 ±0.16a8.22 ±0.80b0.011

Characterisation of haplotypes and association analysis with weight and primary body growth traits in Dicentrarchus labrax

HaplotypeFrequencyTW (g)FW (g)SL (cm)BL (cm)BH (cm)
Block 1GCG0.453456.30 ± 11.06b244.20 ± 5.97b29.03 ± 0.23b21.54 ± 0.18b7.50 ± 0.07
GTG0.287435.37 ± 17.78b227.18 ± 9.06ab29.35 ± 0.39b21.16 ± 0.28b7.28 ± 0.12
ACA0.177494.58 ± 12.79ab265.17 ± 7.04ab30.18 ± 0.28ab22.10 ± 0.22ab7.57 ± 0.09
GTA0.040554.56 ± 34.78a286.63 ± 19.12a31.27 ± 0.86a22.98 ± 0.58a7.79 ± 0.18
Block 2AG0.595500.73 ± 10.47a265.28 ± 5.37a30.14 ± 0.23a22.09 ± 0.17a7.75 ± 0.07a
GG0.240402.60 ± 16.48b215.41 ± 6.32b28.74 ± 0.28b21.01 ± 0.19b7.13 ± 0.09b
AA0.165392.69 ± 18.15b206.90 ± 10.56b27.73 ± 0.41b20.32 ± 0.29b6.82 ± 0.10b

Characterisation of haplotypes and association analysis with segmental body growth traits in Dicentrarchus labrax

HaplotypeFrequencyHL (cm)PecAL (cm)AL (cm)PostAL (cm)HH (cm)
Block 1GCG0.4538.25 ± 0.1321.05 ± 0.2113.52 ± 0.15b9.12 ± 0.10b5.04 ± 0.04
GTG0.2877.92 ± 0.1421.06 ± 0.3213.44 ± 0.19b8.93 ± 0.12ab5.01 ± 0.09
ACA0.1778.17 ± 0.0121.75 ± 0.2413.95 ± 0.17ab9.47 ± 0.10ab5.22 ± 0.06
GTA0.0408.33 ± 0.3422.75 ± 0.7114.66 ± 0.42a9.66 ± 0.32a5.26 ± 0.14
Block 2AG0.5958.29 ± 0.11a21.70 ± 0.20a13.93 ± 0.13a9.37 ± 0.08a5.24 ± 0.05a
GG0.2408.03 ± 0.13a20.75 ± 0.22b13.28 ± 0.14b8.96 ± 0.09b4.89 ± 0.06b
AA0.1657.51 ± 0.12b20.03 ± 0.33b12.82 ± 0.22b8.53 ± 0.01c4.61 ± 0.06c

Single-nucleotide polymorphisms (SNPs) identified in the Dicentrarchus labrax lep gene

SNPPositionRef. seq.SNP siteRegionMutations
111005825*TC>T>YIntron 1-
211005698*CT>C>YIntron 1-
311005646*AC>A>MIntron 1-
411005643*CT>C>YIntron 1-
511005525*CA>C>MIntron 1-
611005514*CT>C>YIntron 1-
711005335*GA>G>RIntron 1-
811005304*AG>A>RIntron 1-
911005020*TC>G>T>BIntron2-
1011004804*GA>G>RExon 3Synonym (glutamic acid)
1111004767*CT>C>YExon 3Non synonym (arginine → tryptophan)
1211004714*GA>G>RExon 3Synonym (lysine)
Language: English
Page range: 293 - 302
Submitted on: Nov 5, 2025
Accepted on: Apr 15, 2026
Published on: Apr 18, 2026
In partnership with: Paradigm Publishing Services

© 2026 Emel Özcan Gökçek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.