Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Gene region	Primer sequence (5′–3′)	Annealing	Sequenced regions of lep gene of Dicentrarchus labrax	Length
Lep-1	F: GTTGGTTAGAGGGAGCTGT R: ACCATTGTCTCAGCTCACCA	59°C	Exon 1 and partial region of intron 1	849 bp
Lep-2	F: CAGGGGGAGAATGCAAAGT R: CATTCAGTTCAGTTCCCCGT	61°C	Partial region of intron 1, exon 2, intron 2 and exon 3	856 bp

Table 2.

Descriptive statistics for production traits

Traits	Min	Max	Mean (SD)	CV (%)
TW (g)	171.05	863.60	459.35 (156.97)	34
FW (g)	81.11	417.44	243.68 (82.99)	34
SL (cm)	21.38	36.47	29.41 (3.46)	12
BL (cm)	15.45	27.47	21.54 (2.55)	12
HL (cm)	5.21	18.87	8.10 (1.56)	19
PecAL (cm)	10.94	26.91	21.19 (2.92)	14
AL (cm)	7.67	17.73	13.59 (1.91)	14
PostAL (cm)	4.55	11.63	9.13 (1.22)	13
HH (cm)	3.65	6.88	5.05 (0.72)	14
BH (cm)	5.17	10.02	7.45 (1.04)	14

1 CV – coefficient of variation. TW –total weight; FW – fillet weight; SL –standard length; BL – body length; HL – head length; PecAL – pectoral–anal length; AL – abdominal length; PostAL – post-anal length; HH – head height; BH – body height

Partial sequence of polymorphisms in the *lep* gene of *Dicentrarchus labrax*. (a) g.11005646A>C; (b) g.11004767C>T; (c) g.11005020T>C>G. Chromatograms were generated from the reverse sequence

Table 3.

Single-nucleotide polymorphisms (SNPs) identified in the Dicentrarchus labrax lep gene

SNP	Position	Ref. seq.	SNP site	Region	Mutations
1	11005825*	T	C>T>Y	Intron 1	-
2	11005698*	C	T>C>Y	Intron 1	-
3	11005646*	A	C>A>M	Intron 1	-
4	11005643*	C	T>C>Y	Intron 1	-
5	11005525*	C	A>C>M	Intron 1	-
6	11005514*	C	T>C>Y	Intron 1	-
7	11005335*	G	A>G>R	Intron 1	-
8	11005304*	A	G>A>R	Intron 1	-
9	11005020*	T	C>G>T>B	Intron2	-
10	11004804*	G	A>G>R	Exon 3	Synonym (glutamic acid)
11	11004767*	C	T>C>Y	Exon 3	Non synonym (arginine → tryptophan)
12	11004714*	G	A>G>R	Exon 3	Synonym (lysine)

1* – position numbered according to GenBank reference sequence NW_026136720 (minus strand)

Table 4.

Genetic diversity parameters based on single-nucleotide polymorphisms in the Dicentrarchus labrax lep gene

Locus	Number of samples	MAF	H_e	H_o	PIC	HWE
11004714G>A	GG: 252 GA: 140 AA: 8	0.195	0.314	0.350	0.265	0.021*
11004767C>T	CC: 124 CT: 276	0.345	0.452	0.690	0.350	0.000*
11004804G>A	GG: 200 GA: 192 AA: 8	0.260	0.385	0.480	0.311	0.000*
11005304A>G	AA: 208 AG: 192	0.240	0.365	0.480	0.298	0.000*
11005335G>A	GG: 292 GA: 84 AA: 24	0.165	0.276	0.210	0.238	0.000*

1 MAF – minor allele frequency; H_e – expected heterozygosity; H_o – observed heterozygosity; PIC – polymorphic information content; HWE – Hardy-Weinberg equilibrium;

1* –statistically significant differences (P-value < 0.05)

Linkage disequilibrium plot of the *Dicentrarchus labrax lep* gene. The values represent r² × 100

Table 5.

Associations between the lep genotypes and the growth traits of Dicentrarchus labrax

Trait	Locus	Genotype			P-value
Trait	Locus	GG	GA	AA	P-value
TW (g)	g.11004714 G>A	433.72 ±19.60^ab	513.35 ±25.37^a	359.98 ±19.11^b	0.033
FW (g)	g.11004714 G>A	229.57 ± 10.34^ab	273.60 ±13.39^a	187.70 ±7.58^b	0.024
SL (cm)	g.11004714 G>A	28.67 ±0.43^ab	30.44 ± 0.55^a	26.80 ±2.40^b	0.027
BL (cm)	g.11004714 G>A	21.10 ±0.34^ab	22.40 ±0.40^a	19.34 ±1.75^b	0.022
PostAL (cm)	g.11004714 G>A	8.95 ±0.15^ab	9.54 ±0.19^a	8.23 ±0.81^b	0.027
	g.11004804 G>A	8.84 ±0.16^ab	9.50 ±0.16^a	8.22 ±0.80^b	0.011

1 TW – total weight; FW – fillet weight; SL – standard length; BL – body length; PostAL – post-anal length;

1a,b –different superscripts within the same row indicate significant difference at P-value < 0.05

Table 6.

Characterisation of haplotypes and association analysis with weight and primary body growth traits in Dicentrarchus labrax

	Haplotype	Frequency	TW (g)	FW (g)	SL (cm)	BL (cm)	BH (cm)
Block 1	GCG	0.453	456.30 ± 11.06^b	244.20 ± 5.97^b	29.03 ± 0.23^b	21.54 ± 0.18^b	7.50 ± 0.07
	GTG	0.287	435.37 ± 17.78^b	227.18 ± 9.06^ab	29.35 ± 0.39^b	21.16 ± 0.28^b	7.28 ± 0.12
	ACA	0.177	494.58 ± 12.79^ab	265.17 ± 7.04^ab	30.18 ± 0.28^ab	22.10 ± 0.22^ab	7.57 ± 0.09
	GTA	0.040	554.56 ± 34.78^a	286.63 ± 19.12^a	31.27 ± 0.86^a	22.98 ± 0.58^a	7.79 ± 0.18
Block 2	AG	0.595	500.73 ± 10.47^a	265.28 ± 5.37^a	30.14 ± 0.23^a	22.09 ± 0.17^a	7.75 ± 0.07^a
	GG	0.240	402.60 ± 16.48^b	215.41 ± 6.32^b	28.74 ± 0.28^b	21.01 ± 0.19^b	7.13 ± 0.09^b
	AA	0.165	392.69 ± 18.15^b	206.90 ± 10.56^b	27.73 ± 0.41^b	20.32 ± 0.29^b	6.82 ± 0.10^b

1 TW – total weight; FW – fillet weight; SL – standard length; BL – body length; BH – body height;

1a,b –different superscripts within the same row indicate significant difference between haplotype blocks at P-value < 0.01

Table 7.

Characterisation of haplotypes and association analysis with segmental body growth traits in Dicentrarchus labrax

	Haplotype	Frequency	HL (cm)	PecAL (cm)	AL (cm)	PostAL (cm)	HH (cm)
Block 1	GCG	0.453	8.25 ± 0.13	21.05 ± 0.21	13.52 ± 0.15b	9.12 ± 0.10^b	5.04 ± 0.04
	GTG	0.287	7.92 ± 0.14	21.06 ± 0.32	13.44 ± 0.19b	8.93 ± 0.12^ab	5.01 ± 0.09
	ACA	0.177	8.17 ± 0.01	21.75 ± 0.24	13.95 ± 0.17^ab	9.47 ± 0.10^ab	5.22 ± 0.06
	GTA	0.040	8.33 ± 0.34	22.75 ± 0.71	14.66 ± 0.42^a	9.66 ± 0.32^a	5.26 ± 0.14
Block 2	AG	0.595	8.29 ± 0.11^a	21.70 ± 0.20^a	13.93 ± 0.13^a	9.37 ± 0.08^a	5.24 ± 0.05^a
	GG	0.240	8.03 ± 0.13^a	20.75 ± 0.22^b	13.28 ± 0.14^b	8.96 ± 0.09^b	4.89 ± 0.06^b
	AA	0.165	7.51 ± 0.12^b	20.03 ± 0.33^b	12.82 ± 0.22^b	8.53 ± 0.01^c	4.61 ± 0.06^c

1 HL – head length; PecAL – pectoral-anal length; AL – abdominal length; PostAL – post-anal length; HH – head height;

1a,b,c –different superscripts within the same row indicate significant difference between haplotype blocks at P-value < 0.01

ConSurf database analysis of the leptin isoform X1 protein of *Dicentrarchus labrax*

Structural comparison of wild-type and mutant leptin isoform X1. The conservation analysis of the leptin isoform X1 protein predicted that the arginine amino acid located at position 159, which is marked, is not in an evolutionarily conserved region

Articles in this issue

DOI: https://doi.org/10.2478/jvetres-2026-0021 | Journal eISSN: 2450-8608 (formerly 2300-3235)

Journal RSS Feed

Language: English

Page range: 293 - 302

Submitted on: Nov 5, 2025

Accepted on: Apr 15, 2026

Published on: Apr 18, 2026

Published by: National Veterinary Research Institute in Pulawy

In partnership with: Paradigm Publishing Services

Keywords:

Related subjects:

Microbiology and virology,

Life sciences, other,

Medicine,

Veterinary medicine

© 2026 Emel Özcan Gökçek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.

Volume 70 (2026): Issue 2 (June 2026)

Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Figures & Tables

Table 1.

Table 2.

Fig. 1.

Table 3.

Table 4.

Fig. 2.

Table 5.

Table 6.

Table 7.

Fig.3.

Fig.4.

Paradigm

My account