Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Emel Özcan Gökçek

doi:10.2478/jvetres-2026-0021

.blurhash-client-img { display: none !important; }

Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Journal of Veterinary Research

AHEAD OF PRINT

By: Emel Özcan Gökçek

Open Access

|Apr 2026

Figures & Tables

Partial sequence of polymorphisms in the lep gene of Dicentrarchus labrax. (a) g.11005646A>C; (b) g.11004767C>T; (c) g.11005020T>C>G. Chromatograms were generated from the reverse sequence

Linkage disequilibrium plot of the Dicentrarchus labrax lep gene. The values represent r2 × 100

ConSurf database analysis of the leptin isoform X1 protein of Dicentrarchus labrax

Structural comparison of wild-type and mutant leptin isoform X1. The conservation analysis of the leptin isoform X1 protein predicted that the arginine amino acid located at position 159, which is marked, is not in an evolutionarily conserved region

Descriptive statistics for production traits

Traits	Min	Max	Mean (SD)	CV (%)
TW (g)	171.05	863.60	459.35 (156.97)	34
FW (g)	81.11	417.44	243.68 (82.99)	34
SL (cm)	21.38	36.47	29.41 (3.46)	12
BL (cm)	15.45	27.47	21.54 (2.55)	12
HL (cm)	5.21	18.87	8.10 (1.56)	19
PecAL (cm)	10.94	26.91	21.19 (2.92)	14
AL (cm)	7.67	17.73	13.59 (1.91)	14
PostAL (cm)	4.55	11.63	9.13 (1.22)	13
HH (cm)	3.65	6.88	5.05 (0.72)	14
BH (cm)	5.17	10.02	7.45 (1.04)	14

Genetic diversity parameters based on single-nucleotide polymorphisms in the Dicentrarchus labrax lep gene

Locus	Number of samples	MAF	H_e	H_o	PIC	HWE
11004714G>A	GG: 252GA: 140AA: 8	0.195	0.314	0.350	0.265	0.021*
11004767C>T	CC: 124CT: 276	0.345	0.452	0.690	0.350	0.000*
11004804G>A	GG: 200GA: 192AA: 8	0.260	0.385	0.480	0.311	0.000*
11005304A>G	AA: 208AG: 192	0.240	0.365	0.480	0.298	0.000*
11005335G>A	GG: 292GA: 84AA: 24	0.165	0.276	0.210	0.238	0.000*

Primers used to amplify 1,655 base pairs of the Dicentrarchus labrax lep gene sequence

Gene region	Primer sequence (5′–3′)	Annealing	Sequenced regions of lep gene of Dicentrarchus labrax	Length
Lep-1	F: GTTGGTTAGAGGGAGCTGTR: ACCATTGTCTCAGCTCACCA	59°C	Exon 1 and partial region of intron 1	849 bp
Lep-2	F: CAGGGGGAGAATGCAAAGTR: CATTCAGTTCAGTTCCCCGT	61°C	Partial region of intron 1, exon 2, intron 2 and exon 3	856 bp

Associations between the lep genotypes and the growth traits of Dicentrarchus labrax

Trait	Locus	Genotype			P-value
Trait	Locus	GG	GA	AA	P-value
TW (g)	g.11004714 G>A	433.72 ±19.60^ab	513.35 ±25.37^a	359.98 ±19.11^b	0.033
FW (g)	g.11004714 G>A	229.57 ± 10.34^ab	273.60 ±13.39^a	187.70 ±7.58^b	0.024
SL (cm)	g.11004714 G>A	28.67 ±0.43^ab	30.44 ± 0.55^a	26.80 ±2.40^b	0.027
BL (cm)	g.11004714 G>A	21.10 ±0.34^ab	22.40 ±0.40^a	19.34 ±1.75^b	0.022
PostAL (cm)	g.11004714 G>A	8.95 ±0.15^ab	9.54 ±0.19^a	8.23 ±0.81^b	0.027
	g.11004804 G>A	8.84 ±0.16^ab	9.50 ±0.16^a	8.22 ±0.80^b	0.011

Characterisation of haplotypes and association analysis with weight and primary body growth traits in Dicentrarchus labrax

	Haplotype	Frequency	TW (g)	FW (g)	SL (cm)	BL (cm)	BH (cm)
Block 1	GCG	0.453	456.30 ± 11.06^b	244.20 ± 5.97^b	29.03 ± 0.23^b	21.54 ± 0.18^b	7.50 ± 0.07
	GTG	0.287	435.37 ± 17.78^b	227.18 ± 9.06^ab	29.35 ± 0.39^b	21.16 ± 0.28^b	7.28 ± 0.12
	ACA	0.177	494.58 ± 12.79^ab	265.17 ± 7.04^ab	30.18 ± 0.28^ab	22.10 ± 0.22^ab	7.57 ± 0.09
	GTA	0.040	554.56 ± 34.78^a	286.63 ± 19.12^a	31.27 ± 0.86^a	22.98 ± 0.58^a	7.79 ± 0.18
Block 2	AG	0.595	500.73 ± 10.47^a	265.28 ± 5.37^a	30.14 ± 0.23^a	22.09 ± 0.17^a	7.75 ± 0.07^a
	GG	0.240	402.60 ± 16.48^b	215.41 ± 6.32^b	28.74 ± 0.28^b	21.01 ± 0.19^b	7.13 ± 0.09^b
	AA	0.165	392.69 ± 18.15^b	206.90 ± 10.56^b	27.73 ± 0.41^b	20.32 ± 0.29^b	6.82 ± 0.10^b

Characterisation of haplotypes and association analysis with segmental body growth traits in Dicentrarchus labrax

	Haplotype	Frequency	HL (cm)	PecAL (cm)	AL (cm)	PostAL (cm)	HH (cm)
Block 1	GCG	0.453	8.25 ± 0.13	21.05 ± 0.21	13.52 ± 0.15b	9.12 ± 0.10^b	5.04 ± 0.04
	GTG	0.287	7.92 ± 0.14	21.06 ± 0.32	13.44 ± 0.19b	8.93 ± 0.12^ab	5.01 ± 0.09
	ACA	0.177	8.17 ± 0.01	21.75 ± 0.24	13.95 ± 0.17^ab	9.47 ± 0.10^ab	5.22 ± 0.06
	GTA	0.040	8.33 ± 0.34	22.75 ± 0.71	14.66 ± 0.42^a	9.66 ± 0.32^a	5.26 ± 0.14
Block 2	AG	0.595	8.29 ± 0.11^a	21.70 ± 0.20^a	13.93 ± 0.13^a	9.37 ± 0.08^a	5.24 ± 0.05^a
	GG	0.240	8.03 ± 0.13^a	20.75 ± 0.22^b	13.28 ± 0.14^b	8.96 ± 0.09^b	4.89 ± 0.06^b
	AA	0.165	7.51 ± 0.12^b	20.03 ± 0.33^b	12.82 ± 0.22^b	8.53 ± 0.01^c	4.61 ± 0.06^c

Single-nucleotide polymorphisms (SNPs) identified in the Dicentrarchus labrax lep gene

SNP	Position	Ref. seq.	SNP site	Region	Mutations
1	11005825*	T	C>T>Y	Intron 1	-
2	11005698*	C	T>C>Y	Intron 1	-
3	11005646*	A	C>A>M	Intron 1	-
4	11005643*	C	T>C>Y	Intron 1	-
5	11005525*	C	A>C>M	Intron 1	-
6	11005514*	C	T>C>Y	Intron 1	-
7	11005335*	G	A>G>R	Intron 1	-
8	11005304*	A	G>A>R	Intron 1	-
9	11005020*	T	C>G>T>B	Intron2	-
10	11004804*	G	A>G>R	Exon 3	Synonym (glutamic acid)
11	11004767*	C	T>C>Y	Exon 3	Non synonym (arginine → tryptophan)
12	11004714*	G	A>G>R	Exon 3	Synonym (lysine)

Articles in this issue

DOI: https://doi.org/10.2478/jvetres-2026-0021 | Journal eISSN: 2450-8608

Journal RSS Feed

Language: English

Submitted on: Nov 5, 2025

Accepted on: Apr 15, 2026

Published on: Apr 18, 2026

Published by: National Veterinary Research Institute in Pulawy

In partnership with: Paradigm Publishing Services

Publication frequency: 4 issues per year

Keywords:

Related subjects:

Microbiology and virology,

Life sciences, other,

Medicine,

Veterinary medicine

© 2026 Emel Özcan Gökçek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.

AHEAD OF PRINT

Novel SNPs in the leptin gene: implications for growth performance in cultured European sea bass (Dicentrarchus labrax)

Figures & Tables

Fig. 1.

Fig. 2.

Fig.3.

Fig.4.

Descriptive statistics for production traits

Genetic diversity parameters based on single-nucleotide polymorphisms in the Dicentrarchus labrax lep gene

Primers used to amplify 1,655 base pairs of the Dicentrarchus labrax lep gene sequence

Associations between the lep genotypes and the growth traits of Dicentrarchus labrax

Characterisation of haplotypes and association analysis with weight and primary body growth traits in Dicentrarchus labrax

Characterisation of haplotypes and association analysis with segmental body growth traits in Dicentrarchus labrax

Single-nucleotide polymorphisms (SNPs) identified in the Dicentrarchus labrax lep gene

Paradigm

My account