Have a personal or library account? Click to login
Investigation of an association between in vitro expression of TMEM154 and PARP14 genes and restriction of SRLV infection in primary skin cells of Carpathian goats Cover

Investigation of an association between in vitro expression of TMEM154 and PARP14 genes and restriction of SRLV infection in primary skin cells of Carpathian goats

Journal of Veterinary Research
AHEAD OF PRINT
By: Magdalena Materniak-Kornas,  Marlena Smagacz,  Katarzyna Ropka-Molik,  Aldona Kawęcka,  Jacek Sikora and  Jacek Michał Kuźmak  
Open Access
|Dec 2025

Figures & Tables

Fig. 1.

Photomicrographs of skin cells: A – uninfected cells; B – cultured cells at 7 days after SRLV infection (arrows indicate syncytia)
Photomicrographs of skin cells: A – uninfected cells; B – cultured cells at 7 days after SRLV infection (arrows indicate syncytia)

Fig. 2.

Kinetics of SRLV replication in experimentally infected skin cells from a high-proviral-load goat (solid orange line), a low-proviral-load goat (solid blue line) and an uninfected goat (solid green line) and these kinetics in cells left without experimental infection from the same goats (dashed lines)
Kinetics of SRLV replication in experimentally infected skin cells from a high-proviral-load goat (solid orange line), a low-proviral-load goat (solid blue line) and an uninfected goat (solid green line) and these kinetics in cells left without experimental infection from the same goats (dashed lines)

Fig. 3.

Relative gene expression in skin cells of goats Nos 5, 8 and 19 experimentally infected with SRLV and in these cells from all three animals left without experimental infection as controls. HPL – high proviral load; LPL – low proviral load; TMEM154 – transmembrane protein 154; PARP14 – poly ADP-ribose polymerase
Relative gene expression in skin cells of goats Nos 5, 8 and 19 experimentally infected with SRLV and in these cells from all three animals left without experimental infection as controls. HPL – high proviral load; LPL – low proviral load; TMEM154 – transmembrane protein 154; PARP14 – poly ADP-ribose polymerase

Fig. 4.

Known and probable functions of the PARP14 protein. STAT – signal transducer and activator of transcription; IFN – interferon; IL-4 – interleukin 4
Known and probable functions of the PARP14 protein. STAT – signal transducer and activator of transcription; IFN – interferon; IL-4 – interleukin 4

Primers used in the analysis of gene expression

GeneSequence of the primer (5'-3')OrientationFragment lengthReference
GAPDHTTCTGGCAAAGTGGACATCGTF112 bp(19)
CTTGACTGTGCCGTTGAACTTGR
TMEM154ATTTCTCTGTCACCTGGCCAF155 bp(18)
AGACAGCAAACAAAGCAAGTATTR
PARP14CGGGTACTCACTGGATGCTAF203 bp(18)
TCTGCAAAGGTTACCAAAATGTTR
DOI: https://doi.org/10.2478/jvetres-2025-0072 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Submitted on: Aug 18, 2025
Accepted on: Dec 10, 2025
Published on: Dec 17, 2025
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
small ruminant lentivirus,
goat,
restriction factor,
skin culture,
retrovirus,
susceptibility to infection
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2025 Magdalena Materniak-Kornas, Marlena Smagacz, Katarzyna Ropka-Molik, Aldona Kawęcka, Jacek Sikora, Jacek Michał Kuźmak, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.

AHEAD OF PRINT