Skip to main content
Have a personal or library account? Click to login
Molecular response in the pectoral muscles and livers of broiler chickens to mitochondrial stimulation by in ovo administration of prebiotics Cover

Molecular response in the pectoral muscles and livers of broiler chickens to mitochondrial stimulation by in ovo administration of prebiotics

Open Access
|Oct 2025

Figures & Tables

Table 1.

Primer sequences used in the quantitative PCR with initial reverse transcription to analyse mitochondrial gene expression in broilers given early host-supporting prebiotic therapy

GeneFull nameNCBI gene IDPrimer sequence (5ʹ→3ʹ)
CSCitrate synthase100858903F: GCATTTTCCAAGGGTGAGCC
R: CTGTAGGGCTGCAGGAGTG
EPX (MPO)Eosinophil peroxidase417467F: AAGCAACTTCTGCAGGACTGA
R: AGGTTGAGATGACCGCTCTG
CYCSCytochrome c420624F: CCATGAAGGTTGGGTCCAGT
R: CTCTGTGTGTGTTCCTGGTCT
TFAMTranscription factor a, mitochondrial373888F: CCTACGAGAGGGGAGGGG
R: TCGATCCCTGTGTGAACTGC
NRF1Nuclear respiratory factor 1416677F: AAAAGCCCAGAGCTGAATGGT
R: GGCACCGTGCAAAGAGAGAA
ND2NADH dehydrogenase subunit 263549482F: ATCAGCCCTAATCCTCTTCTC
R: GTGGCTATTGGGGTTATTTCT
MnSOD (SOD2)Superoxide dismutase 2, mitochondrial374042F: GCAGCCTGTGCAAATCAAGA
R: ACATCTCATCCATTTGCCTCTGA

1 NCBI – National Center for Biotechnology Information; F – forward; R – reverse; NADH – nicotinamide adenine dinucleotide (reduced)

Table 2.

Physicochemical features of the pectoral muscles of broilers given early host-supporting prebiotic therapy

GroupSEMP-value
ControlXOS3XOS4MOS3MOS4
Pectoral muscle (g)533.40505.04482.34483.70471.968.6600.170
pH24hours5.946.066.056.036.030.0100.119
ColourL*50.4851.0850.0249.3850.330,3200.578
a*2.882.793.022.563.000,1700.923
b*5.384.444.614.125.270,2000.203
Drip loss (%)1.351.561.341.281.650.0600.191
Water-holding capacity (%)30.39b32.40b39.55a32.41b34.70ab0.8400.004

1 XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose;

1L* – lightness;

1a* – redness;

1b* – yellowness; WHC – water-holding capacity; SEM – standard error of the mean;

1a,b – mean values marked with different letters in the row differ statistically significantly, P-value < 0.05

Fig. 1.

Mitochondrial DNA (mtDNA) copy number of adenosine triphosphate subunit 6 (ATP6), nicotinamide adenine dinucleotide (reduced) dehydrogenase subunit 6 (ND6) and displacement loop (D-loop) relative to nuclear DNA (glucagon gene – GCG) in the pectoral muscles of broiler chickens after in ovo stimulation with prebiotics. XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose; * – P-value ≤ 0.05

Fig. 2.

Mitochondrial DNA (mtDNA) copy number of adenosine triphosphate subunit 6 (ATP6), nicotinamide adenine dinucleotide (reduced) dehydrogenase subunit 6 (ND6) and displacement loop (D-loop) relative to nuclear DNA (glucagon gene – GCG) in the livers of broiler chickens after in ovo stimulation with prebiotics. XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose; * – P-value ≤ 0.05

Fig. 3.

Relative mtDNA content in the pectoral muscles and livers of broiler chickens after in ovo stimulation with prebiotics. The GCG gene was used as the genomic DNA reference, and the D-loop gene as the mtDNA reference. XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose; * – P-value ≤ 0.05

Fig. 4.

Expression of genes related to mitochondria in the livers of broiler chickens after in ovo stimulation with prebiotics. XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose; * – P-value ≤ 0.05

Fig. 5.

Expression of genes related to mitochondria in the pectoral muscles of broiler chickens after in ovo stimulation with prebiotics. XOS3 – xylotriose; XOS4 – xylotetraose; MOS3 – mannotriose; MOS4 – mannotetraose; * – P-value ≤ 0.05

DOI: https://doi.org/10.2478/jvetres-2025-0061 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 639 - 646
Submitted on: Apr 8, 2025
Accepted on: Oct 21, 2025
Published on: Oct 30, 2025
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2025 Aleksandra Dunisławska, Aleksandra Bełdowska, Olha Yatsenko, Jakub Biesek, Maria Siwek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.