Have a personal or library account? Click to login
The application of multiplex PCR and PCR-restriction fragment length polymorphism for differentiation of Bacillus anthracis from other Bacillus spp. Cover

The application of multiplex PCR and PCR-restriction fragment length polymorphism for differentiation of Bacillus anthracis from other Bacillus spp.

Journal of Veterinary Research
Volume 69 (2025): Issue 3 (September 2025)
By:
Open Access
|Oct 2025

Figures & Tables

Fig. 1.

Electrophoresis of multiplex PCR products. A. Lanes: 1–4 B.a.v1–4; 5–7 B.a.1–3/47; 8 B.a.4/48; 9 and 10 B.a.5–6/50; 11 B.a.7/51. B. Lanes: 1 B.a.8/52; 2–4 B.a.9–11/53; 5 B.a.12/54; 6–8 B.a.13–15/93; 9 and 10 B.a.16 and 17/96; 11 negative control; M – molecular weight standard
Electrophoresis of multiplex PCR products. A. Lanes: 1–4 B.a.v1–4; 5–7 B.a.1–3/47; 8 B.a.4/48; 9 and 10 B.a.5–6/50; 11 B.a.7/51. B. Lanes: 1 B.a.8/52; 2–4 B.a.9–11/53; 5 B.a.12/54; 6–8 B.a.13–15/93; 9 and 10 B.a.16 and 17/96; 11 negative control; M – molecular weight standard

Fig. 2.

Electrophoresis of multiplex PCR products. A. Lanes: 1–11 B.c.1–11; B. Lanes: 1 and 2 B.c.12 and 13; 3 B.t.1; 4–6 B.m. 1–3; 7 B.ms.1; 8–10 B.s.1–3; 11 negative control; M – molecular weight standard
Electrophoresis of multiplex PCR products. A. Lanes: 1–11 B.c.1–11; B. Lanes: 1 and 2 B.c.12 and 13; 3 B.t.1; 4–6 B.m. 1–3; 7 B.ms.1; 8–10 B.s.1–3; 11 negative control; M – molecular weight standard

Fig. 3.

Electrophoresis of PCR-RFLP products. Lanes: 1 SG-749; 2–5 restriction patterns A, B, C and D; M – molecular weight standard
Electrophoresis of PCR-RFLP products. Lanes: 1 SG-749; 2–5 restriction patterns A, B, C and D; M – molecular weight standard

The characteristics of the PCR-RFLP primers

TargetPrimerSequence (5′–3′)Product sizeConcentration
SG-749S-749fACTGGCTAATTATGTAATG749 bp1.5 μM
S-749rATAATTATCCATTGATTTCG

The characteristics of the multiplex PCR primers

TargetPrimerSequence (5′–3′)Product sizeConcentration
pagPA5TCCTAACACTAACGAAGTCG596 bp1.0 μM
PA8GAGGTAGAAGGATATACGGT
cap1234CTGAGCCATTAATCGATATG846 bp0.2 μM
1301TCCCACTTACGTAATCTGAG
Ba813R1TTAATTCACTTGCAACTGATGGG152 bp0.5 μM
R2AACGATAGCTCCTACATTTGGAG

Results of PCR-RFLP

StrainPresence of the SG-749 sequenceRestriction pattern
B. anthracis B.a.v1+A
B. anthracis B.a.v2+A
B. anthracis B.a.v3+A
B. anthracis B.a.v4+A
B. anthracis B.a.1/47+A
B. anthracis B.a.2/47+A
B. anthracis B.a.3/47+A
B. anthracis B.a.4/48+A
B. anthracis B.a.5/50+A
B. anthracis B.a.6/50+A
B. anthracis B.a.7/51+A
B. anthracis B.a.8/52+A
B. anthracis B.a.9/53+A
B. anthracis B.a.10/53+A
B. anthracis B.a.11/53+A
B. anthracis B.a.12/54+A
B. anthracis B.a.13/93+A
B. anthracis B.a.14/93+A
B. anthracis B.a.15/93+A
B. anthracis B.a.16/96+A
B. anthracis B.a.17/96+A
B. cereus B.c.1+B
B. cereus B.c.2+B
B. cereus B.c.3+C
B. cereus B.c.4+B
B. cereus B.c.5+B
B. cereus B.c.6+C
B. cereus B.c.7+C
B. cereus B.c.8+C
B. cereus B.c.9+C
B. cereus B.c.10+C
B. cereus B.c.11+C
B. cereus B.c.12+D
B. cereus B.c.13+C
B. thuringiensis B.t.1+C
B. megaterium B.m.1+C
B. megaterium B.m.2+C
B. megaterium B.m.3+C
B. mycoides B.ms.1+C
B. subtilis B.s.1–ND*
B. subtilis B.s.2–ND
B. subtilis B.s.3–ND
DOI: https://doi.org/10.2478/jvetres-2025-0053 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 325 - 330
Submitted on: Apr 4, 2025
Accepted on: Sep 24, 2025
Published on: Oct 3, 2025
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 times per year
Keywords:
anthrax,
group,
PCR,
PCR-RFLP
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2025 Agnieszka Kędrak-Jabłońska, Sylwia Budniak, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 69 (2025): Issue 3 (September 2025)Next article