Table 1.
The characteristics of the multiplex PCR primers
| Target | Primer | Sequence (5′–3′) | Product size | Concentration |
|---|---|---|---|---|
| pag | PA5 | TCCTAACACTAACGAAGTCG | 596 bp | 1.0 μM |
| PA8 | GAGGTAGAAGGATATACGGT | |||
| cap | 1234 | CTGAGCCATTAATCGATATG | 846 bp | 0.2 μM |
| 1301 | TCCCACTTACGTAATCTGAG | |||
| Ba813 | R1 | TTAATTCACTTGCAACTGATGGG | 152 bp | 0.5 μM |
| R2 | AACGATAGCTCCTACATTTGGAG |
Table 2.
The characteristics of the PCR-RFLP primers
| Target | Primer | Sequence (5′–3′) | Product size | Concentration |
|---|---|---|---|---|
| SG-749 | S-749f | ACTGGCTAATTATGTAATG | 749 bp | 1.5 μM |
| S-749r | ATAATTATCCATTGATTTCG |

Fig. 1.
Electrophoresis of multiplex PCR products. A. Lanes: 1–4 B.a.v1–4; 5–7 B.a.1–3/47; 8 B.a.4/48; 9 and 10 B.a.5–6/50; 11 B.a.7/51. B. Lanes: 1 B.a.8/52; 2–4 B.a.9–11/53; 5 B.a.12/54; 6–8 B.a.13–15/93; 9 and 10 B.a.16 and 17/96; 11 negative control; M – molecular weight standard

Fig. 2.
Electrophoresis of multiplex PCR products. A. Lanes: 1–11 B.c.1–11; B. Lanes: 1 and 2 B.c.12 and 13; 3 B.t.1; 4–6 B.m. 1–3; 7 B.ms.1; 8–10 B.s.1–3; 11 negative control; M – molecular weight standard
Table 3.
Results of PCR-RFLP
| Strain | Presence of the SG-749 sequence | Restriction pattern |
|---|---|---|
| B. anthracis B.a.v1 | + | A |
| B. anthracis B.a.v2 | + | A |
| B. anthracis B.a.v3 | + | A |
| B. anthracis B.a.v4 | + | A |
| B. anthracis B.a.1/47 | + | A |
| B. anthracis B.a.2/47 | + | A |
| B. anthracis B.a.3/47 | + | A |
| B. anthracis B.a.4/48 | + | A |
| B. anthracis B.a.5/50 | + | A |
| B. anthracis B.a.6/50 | + | A |
| B. anthracis B.a.7/51 | + | A |
| B. anthracis B.a.8/52 | + | A |
| B. anthracis B.a.9/53 | + | A |
| B. anthracis B.a.10/53 | + | A |
| B. anthracis B.a.11/53 | + | A |
| B. anthracis B.a.12/54 | + | A |
| B. anthracis B.a.13/93 | + | A |
| B. anthracis B.a.14/93 | + | A |
| B. anthracis B.a.15/93 | + | A |
| B. anthracis B.a.16/96 | + | A |
| B. anthracis B.a.17/96 | + | A |
| B. cereus B.c.1 | + | B |
| B. cereus B.c.2 | + | B |
| B. cereus B.c.3 | + | C |
| B. cereus B.c.4 | + | B |
| B. cereus B.c.5 | + | B |
| B. cereus B.c.6 | + | C |
| B. cereus B.c.7 | + | C |
| B. cereus B.c.8 | + | C |
| B. cereus B.c.9 | + | C |
| B. cereus B.c.10 | + | C |
| B. cereus B.c.11 | + | C |
| B. cereus B.c.12 | + | D |
| B. cereus B.c.13 | + | C |
| B. thuringiensis B.t.1 | + | C |
| B. megaterium B.m.1 | + | C |
| B. megaterium B.m.2 | + | C |
| B. megaterium B.m.3 | + | C |
| B. mycoides B.ms.1 | + | C |
| B. subtilis B.s.1 | – | ND* |
| B. subtilis B.s.2 | – | ND |
| B. subtilis B.s.3 | – | ND |

Fig. 3.
Electrophoresis of PCR-RFLP products. Lanes: 1 SG-749; 2–5 restriction patterns A, B, C and D; M – molecular weight standard