Table 1.
Primers used for quantitative reverse-transcription PCR to determine nuclear factor erythroid 2-related factor 2 (Nrf2) pathway genes in liver and kidney tissue from Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds
| Gene | Sense primer (5′–3′) | Antisense primer (5′–3′) | GenBank accession No. |
|---|---|---|---|
| Nrf2 | CACATCCAGACAGACACCAGT | CTACAAATGGGAATGTCTCTGC | XM_006234398.3 |
| HO-1 | ACAGGGTGACAGAAGAGGCTAA | TCAAGAGGAGCAGAAAAAGAACAAG | NM_012580.2 |
| NQO1 | CTGTGAGGGACTCTGGTCTTTG | CTGAAAGCAAGCCAGGCAAAC | NM_017000.3 |
| β-actin | GGTGGGTATGGGTCAG | ATGCCGTGTTCAATGG | NM_031144.3 |

Fig. 1.
The inhibitory effect on murine RAW264.7 macrophage cells of different α-lipoic acid and diclofenac sodium concentrations on A) nitric oxide (NO) production and B) cell viability assayed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (n = 3). Data was expressed as mean ± standard deviation. IC50 – half maximal inhibitory concentration; ** and **** – significant difference relative to the negative control at P-value < 0.01 and P-value < 0.0001, respectively

Fig. 2.
The inhibitory effect in murine RAW264.7 macrophage cells of different alpha lipoic acid (ALA) and diclofenac sodium concentrations on reactive oxygen species (ROS) production. Data are expressed as mean ± standard deviation, n = 3. EC50 – half maximal effective concentration; TBHP – tert-butyl hydroperoxide; ** and *** – significant differences at P-value ≤ 0.005 and 0.0005, respectively

Fig. 3.
The effect of hepatoprotective compounds on hepatic and renal oxidative biomarkers in Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) and contrast in rats denied the compounds. A and D – effect on malondialdehyde (MDA); B and E – effect on catalase (CAT); C and F – effect on reduced glutathione (GSH). Data are expressed as mean ± standard deviation. n = 7 rats/group. * and ** – significant difference vs negative control group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively; # and ## – significant difference vs DIC group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively; SLY – silymarin at 100 mg/kg body weight (b.w.); ALA 50 – α-lipoic acid at 50 mg/kg b.w.; ALA 100 – α-lipoic acid at 100 mg/kg b.w.
Table 2.
Biochemical analysis of liver and kidney function markers in in Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds
| Biomarker | Group | Biomarker | Group | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | DIC | SLY | ALA 50 | ALA 100 | Control | DIC | SLY | ALA 50 | ALA 100 | ||
| ALT (U/L) | 36.14## ± 3.53 | 82.29** ± 6.70 | 65.71**, ## ± 6.87 | 72.14**, ## ± 3.29 | 40.71## ± 3.50 | Albumin (g/dL) | 4.24## ± 0.17 | 3.24** ± 0.25 | 3.70**, ## ± 0.14 | 3.63**, ## ± 0.11 | 3.82**, ## ± 0.37 |
| AST (U/L) | 53.71## ± 3.59 | 101.43** ± 8.60 | 72.29**, ## ± 5.38 | 72.29**, ## ± 5.56 | 58.00## ± 3.06 | Globulin (g/dL) | 2.98## ± 0.37 | 1.84** ± 0.45 | 2.71**, ## ± 0.44 | 2.71## ± 0.43 | 3.19## ± 0.54 |
| ALP (U/L) | 134.29## ± 10.40 | 194.43** ± 9.81 | 165.29**, ## ± 9.48 | 159.43**, ## ± 8.72 | 142.29**, ## ± 10.26 | Urea (mg/dL) | 29.14## ± 3.72 | 95.14** ± 5.05 | 87.29**, ## ± 4.92 | 64.14**, ## ± 6.77 | 39.57**, ## ± 4.31 |
| Total bilirubin (μmol/L) | 6.10## ± 0.66 | 9.83** ± 1.75 | 7.80**, ## ± 0.52 | 7.62**, ## ± 0.53 | 6.35## ± 0.65 | Creatinine (mg/dL) | 0.65## ± 0.58 | 1.64** ± 0.17 | 1.29**, ## ± 0.10 | 1.02**, ## ± 0.13± | 0.76## ± 0.10 |
| Total proteins (g/dL) | 7.23## ± 0.33 | 5.08** ± 0.38 | 6.42**, ## ± 0.41 | 6.34**, ## ± 0.39 | 7.00## ± 0.46 | Uric acid (mg/dL) | 4.49## ± 0.62 | 19.94** ± 1.07 | 12.60**, ## ± 1.14 | 7.67## ± 1.09± | 6.09## ± 0.85 |

Fig. 4.
Photomicrographs of haematoxylin and eosin–stained sections of the liver in different experimental groups of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A – the liver of a negative control group rat showing normal histological architecture of liver tissue. B – the liver of a DIC-treated and hepatorenally unprotected group rat showing diffused hydropic degeneration of hepatocytes, apoptosis, hepatocellular necrosis and mononuclear infiltration. C – the liver of a silymarin-treated group rat dosed at 100 mg/kg body weight (b.w.) showing hepatocellular regeneration and mild vacuolar degeneration. D – the liver of an α-lipoic acid (ALA)-treated group rat dosed at 50 mg/kg b.w. showing moderate vacuolar degeneration. E – the liver of an ALA-treated group rat dosed at 100 mg/kg b.w. showing marked hepatocellular regeneration, mild cellular necrosis and fatty changes

Fig. 5.
Photomicrographs of haematoxylin and eosin–stained sections of the kidney in different experimental groups of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A – the kidney of a negative control group rat showing normal renal architecture with a normal glomerulus and renal tubule arrangement. B – the kidney of a DIC-treated and hepatorenally unprotected group rat showing vacuolisation in the endothelial lining of the glomerular tuft, congestion of renal vessels, desquamation of tubular cells with intraluminal eosinophilic cast formation, severe fatty change in the epithelial lining of renal tubules and necrosis of renal tubules. C – the kidney of a silymarin-treated group rat dosed at 100 mg/kg body weight (b.w.) showing dilation and congestion of renal vessels, tubular cell desquamation and intraluminal cast formation. D and E – the kidneys of α-lipoic acid–treated group rats dosed at 50 mg/kg b.w. or 100 mg/kg b.w. showing marked improvement in renal alterations, restored normal histological structure of the endothelial cell lining of the glomerular tuft and reduced renal necrosis

Fig. 6.
Histopathological evaluation of hepatic and renal lesion scoring for Wistar rat organs after hepatorenal toxic insult with diclofenac sodium (DIC) preceded by administration of protective compounds and contrast in the organs of rats denied the compounds. A – necro-inflammatory score in liver tissue. B – glomerular, interstitial and vascular score in kidney tissue. Data are expressed as median and interquartile range. Adjusted P values were considered significant at P-value ≤ 0.05. DIC – scores for rats administered DIC and not protected hepatorenally; SLY – scores for rats administered silymarin at 100 mg/kg body weight (b.w.) as hepatorenal protection, ALA 50 – scores for rats administered α-lipoic acid at 50 mg/kg b.w. as hepatorenal protection; ALA 100 – scores for rats administered α-lipoic acid at 100 mg/kg b.w. as hepatorenal protection; * and ** – significant difference vs normal control group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively; # and ## – significance difference vs DIC group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively

Fig. 7.
Photomicrographs of caspase-3 activity in livers in different experimental groups of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A – the liver of a normal control group rat showing no detectable caspase-3 immunostaining. B – the liver of a DIC-treated and hepatorenally unprotected group rat showing strong caspase-3 immunostaining of hepatocytes undergoing apoptosis. C – the liver of a silymarin-treated group rat dosed at 100 mg/kg body weight (b.w.) showing moderately stained hepatocytes. D – the liver of an α-lipoic acid–treated group rat dosed at 50 mg/kg b.w. showing moderate caspase-3 immunostaining of hepatocytes. E – the liver of an α-lipoic acid–treated group rat dosed at 100 mg/kg b.w. showing a reduction of the immunopositive cells

Fig. 8.
Photomicrographs of caspase-3 activity in kidney in the different experimental groups of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A – the kidney of a normal control group rat showing no expression of caspase-3 in the renal corpuscles and tubules. B – the kidney of a DIC-treated and hepatorenally unprotected group rat showing strong positive caspase-3 expression in the glomeruli and tubules. C – the kidney of a silymarin-treated group rat dosed at 100 mg/kg body weight (b.w.) showing moderately stained glomeruli and tubules. D and E – the kidneys of α-lipoic acid–treated group rats dosed at 50 mg/kg b.w. or 100 mg/kg b.w. showing a reduction of the immunopositive cells

Fig. 9.
Image analysis data to evaluate the area corresponding to caspase-3 protein expression in the organs of different experimental groups of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A – caspase-3 immunostaining expressed as area % in liver tissues. B – caspase-3 immunostaining expressed as area % in kidney tissues. Data are expressed as mean +/− standard deviation. DIC – diclofenac; SLY – silymarin at 100 mg/kg body weight (b.w.); ALA 50 – α-lipoic acid at 50 mg/kg b.w.; ALA-100 – α-lipoic acid at 100 mg/kg b.w.; * and ** – significant difference vs normal control group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively; ## – significant difference vs DIC group at P-value ≤ 0.005

Fig. 10.
Alpha-lipoic acid (ALA) effects on the messenger RNA expression levels of genes in the liver and kidney tissues of Wistar rats subjected to hepatorenal toxic insult by diclofenac sodium (DIC) after being administered or denied protective compounds. A and D – effect on nuclear factor erythroid 2-related factor 2 (Nrf2). B and E – effect on nicotinamide adenine (phosphate) reduced form : quinone oxidoreductase 1 (NQO1). C and F – effect on haem oxygenase 1 (HO-1). Data are expressed as mean ± standard deviation. n = 7 rats/group; SLY – silymarin at 100 mg/kg body weight (b.w.); ALA 50 – α-lipoic acid at 50 mg/kg b.w.; ALA 100 – α-lipoic acid at 100 mg/kg b.w.; * and ** significant difference vs normal control group at P-value ≤ 0.05 and P-value ≤ 0.005, respectively; # – significant difference vs DIC group at P-value ≤ 0.05