Have a personal or library account? Click to login
Effect of probiotics on immune cells in young Japanese Black calves responding to vaccination against bacterial respiratory diseases Cover

Effect of probiotics on immune cells in young Japanese Black calves responding to vaccination against bacterial respiratory diseases

Open Access
|Mar 2025

Figures & Tables

Fig. 1.

Changes in antibody titres against Pasteurella multocida, Mannheimia haemolytica and Histophilus somni. Solid circles – research group; hollow circles – control group. Results are expressed as the mean ± standard error (n = 24). O.D. – optimal density
Changes in antibody titres against Pasteurella multocida, Mannheimia haemolytica and Histophilus somni. Solid circles – research group; hollow circles – control group. Results are expressed as the mean ± standard error (n = 24). O.D. – optimal density

Fig. 2.

Changes in numbers of peripheral lymphocyte, CD3+, CD4+, CD8+, CD14+ and MHC class-II cells. Solid circles – research group; hollow circles – control group. *–significant difference (P-value < 0.05) between two groups on the same day of life
Changes in numbers of peripheral lymphocyte, CD3+, CD4+, CD8+, CD14+ and MHC class-II cells. Solid circles – research group; hollow circles – control group. *–significant difference (P-value < 0.05) between two groups on the same day of life

Fig. 3.

Changes in relative gene expressions of interleukin (IL)-4, IL-12p40, IL-17A, interferon (IFN)-γ and transforming growth factor (TGF)-β. Solid circles – research group; hollow circles – control group. *–significant difference (P-value < 0.05) between two groups on the same day of life
Changes in relative gene expressions of interleukin (IL)-4, IL-12p40, IL-17A, interferon (IFN)-γ and transforming growth factor (TGF)-β. Solid circles – research group; hollow circles – control group. *–significant difference (P-value < 0.05) between two groups on the same day of life

Primers used for real-time PCR expression analysis

GeneGenBank Accession No.Product length (base pairs)Primer5′–3′ sequence
IL-4NM_173921117ForwardGCCCCAAAGAACACAACTGA
ReverseGAGATTCCTGTCAAGTCCGC
IL-12p40NM_174356.1101ForwardCACCCCGCATTCCTACTTCT
ReverseTGACTTTGGCTGAGGTTTGG
IL-17ANM_001008412.2138ForwardATCTCACAGCGAGCACAAGT
ReverseGTGGGATGATGACTCCTGCC
IFN-γNM_174086108ForwardTCAAATTCCGGTGGATGATCT
ReverseCTTCTCTTCCGCTTTCTGAGG
TGF-βNM_001166068.1140ForwardTGACCCGCAGAGAGGAAATAG
ReverseGTTCATGCCGTGAATGGTG
β-actinNM_173979.376ForwardTCTTCCATAGGACACAATGCC
ReverseGAGGCATACAGGGACAGCAC

Nutrient composition of diets in the Japanese Black calves

Dietary componentPercentage of dry matter intake from commercial feed diet
Milk replacerStarter
TDN11675
CP2520
Fat252
NDF110
Language: English
Page range: 27 - 33
Submitted on: Jul 31, 2024
Accepted on: Mar 17, 2025
Published on: Mar 25, 2025
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 times per year

© 2025 Shogo Takeda, Hiromichi Ohtsuka, Keigo Kosenda, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution 4.0 License.