Skip to main content
Have a personal or library account? Click to login
Whole genome sequencing and analysis of a goose-derived Mycoplasma gallisepticum in Guangdong Province, China Cover

Whole genome sequencing and analysis of a goose-derived Mycoplasma gallisepticum in Guangdong Province, China

Open Access
|Nov 2024

Figures & Tables

Fig. 1.

Isolation and identification of goose-origin Mycoplasma gallisepticum. A – thickened air-sac wall of an affected goose: wall with white viscous liquid; B – blood in statis in the lung tissue of an affected goose, and large amounts of yellow and white cheese-like material in the air sacs; C – colonies of clinical MG from goose isolates (100×); D – the PCR identification result of goose-origin MG. M – DL1000 Marker; 1 – MG-GD01/22; 2 – MG S6; 3 – Mycoplasma synoviae strain MS wvu1853; 4 – Control

Fig. 2.

Changes caused by Mycoplasma gallisepticum in geese. A – clean nasal cavity; B – normal, thin and transparent air sacs in a control-group goose; C – yellow, viscous secretion in the nasal cavity of an infected-group goose; D – slightly thickened air sacs withs cloudy, light-yellow cheese-like exudation in an infected-group goose

Fig. 3.

Basic information and bioinformatics prediction for Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese. A – visualisation of the MG-GD01/22 genome; B – clustered, regularly interspaced short palindromic repeat fragment SeqLogo of MG-GD01/22. COG – clusters of orthologous groups; GC – guanine + cytosine; CDS – coding sequence; rRNA – ribosomal RNA; tRNA – transfer RNA

Fig. 4.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese based on Cluster of Orthologous Groups (of proteins) (COG) database annotation results

Fig. 5.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on the Gene Ontology (GO) database annotation results

Fig. 6.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotation results

Fig. 7.

Nucleotide sequence homology analysis of the 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese

Fig. 8.

Phylogenetic tree of 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese

Fig. 9.

Phylogenetic tree of mgc2 of MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese

Fig. 10.

Collinearity analysis of the genomes of the Mycoplasma gallisepticum strain MG-GD01/22 (x-axis) isolated from inoculated Chinese geese and the MG S6 strain (y-axis). Forward maximal unique matches (MUMs) are plotted as red lines/dots while reverse MUMs are plotted as blue lines/dots. A line of dots with slope = 1 represents an undisturbed segment of conservation between the two sequences, while a line of slope = −1 represents an inverted segment of conservation between the two sequences

The bioinformatics software used for the prediction and annotation of Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese

PCR reaction system for amplification of Mycoplasma isolates from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

ComponentVolume (μL)
TaKaRa Taq Version 2.0 plus dye5
Forward primer (10μM)0.3
Reverse primer (10μM)0.3
ddH2O3.4
Bacteria solution1

Primers used for PCR analysis of amplicons of Mycoplasma from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

SpeciesPrimer sequences 5’→3’Fragment length (bp)Annealing temperature (°C)
IGSR-F:GTAGGGCCGGTGATTGGAGTTA
Mycoplasma gallisepticumIGSR-R:CCCGTAGCATTTCGCAGGTTTG79257

Pathogen Host Interactions database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

TaxonGene nameGene number
Loss of pathogenicitypmc1, cls10
Increased virulencealgT, gyrA, glyA7
EffectorpstB, groEL7
Unaffected pathogenicityFTT0673p/prsAp, secA23
Reduced virulencesecA, Calcium-transporting2

Minimum inhibitory concentrations (MICs) of antimicrobials against a Mycoplasma gallisepticum reference strain (MG S6) and the isolate obtained in the experiment (MG-GD01)

Drug nameMG S6 MICMG-GD01 MIC
Danofloxacin0.83.2
Enrofloxacin0.43.2
Tilmicosin0.20.4
Tylosin0.20.4
Acetylisovalery ltylosin tartrate0.10.3
Tiamulin0.006250.0125
Valnemulin0.006250.0125
Spectinomycin0.43.2

The Comprehensive Antibiotic Resistance Database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

Antibiotic typeGene nameGene number
FluoroquinoloneparC, gyrB, parE, gyrA10
StreptomycinrpsL1
AminocoumarinalaS, gyrB, parE, parY7
DaptomycinrpoB, rpoC3
RifamycinrpoB2
Other antibioticsmacB, dfrE2
Language: English
Page range: 497 - 508
Submitted on: Apr 18, 2024
Accepted on: Nov 21, 2024
Published on: Nov 28, 2024
In partnership with: Paradigm Publishing Services

© 2024 Yuanyuan Zhou, Shuti Song, Weihuo Li, Yixin Jia, Yangshuo Li, Jingyi Liang, Zhaofeng Yao, Nan Zhang, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.