Table 1.
Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interest
| GenBank accession No. | Gene | Amplicon size (base pairs) | Forward/reverse | Sequence 5’→3’ | Reference | |
|---|---|---|---|---|---|---|
| Housekeeping genes | NM_001034034 | GAPDH glyceraldehyde-3-phosphate dehydrogenase | 134 | forward | AGAAGGCTGGGGCTCACT | (31) |
| reverse | GGCATTGCTGACAATCTTGA | |||||
| U39357 | ACTB β-actin | 168 | forward | CTTCCTTCCTGGGCATGG | ||
| reverse | GGGCAGTGATCTCTTTCTGC | |||||
| BC108088.1 | HDAC1 histone deacetylase1 | 115 | forward | CTGGGGACCTACGGGATATT | ||
| reverse | GACATGACCGGCTTGAAAAT | |||||
| Genes of interest | NM_001009397 | GnRHR gonadotropin-releasing hormone receptor | 150 | forward | TCTTTGCTGGACCACAGTTAT | (14) |
| reverse | GGCAGCTGAAGGTGAAAAAG | |||||
| U02517 | GnRH gonadotropin-releasing hormone | 123 | forward | GCCCTGGAGGAAAGAGAAAT | ||
| reverse | GAGGAGAATGGGACTGGTGA | |||||
| X52488 | LHB luteinising hormone β-subunit | 184 | forward | AGATGCTCCAGGGACTGCT | ||
| reverse | TGCTTCATGCTGAGGCAGTA |
Fig. 1.
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Fig. 2.
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Fig. 3.
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)
Fig. 4.
Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)