Skip to main content
Have a personal or library account? Click to login
Effect of central administration of indomethacin on anandamide-induced GnRH/LH secretion in the hypothalamus of anoestrous ewes Cover

Effect of central administration of indomethacin on anandamide-induced GnRH/LH secretion in the hypothalamus of anoestrous ewes

Journal of Veterinary Research
Volume 68 (2024): Issue 3 (September 2024)
By: Dorota Tomaszewska-Zaremba,  Monika Tomczyk,  Karolina Wojtulewicz,  Joanna Bochenek,  Kinga Pałatyńska and  Andrzej Przemysław Herman  
Open Access
|Jul 2024
Figures & tables

Figures & Tables

Fig. 1.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 2.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 3.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)

Fig. 4.

Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interest

GenBank accession No.GeneAmplicon size (base pairs)Forward/reverseSequence 5’→3’Reference
Housekeeping genesNM_001034034GAPDHglyceraldehyde-3-phosphate dehydrogenase134forwardAGAAGGCTGGGGCTCACT(31)
reverseGGCATTGCTGACAATCTTGA
U39357ACTBβ-actin168forwardCTTCCTTCCTGGGCATGG
reverseGGGCAGTGATCTCTTTCTGC
BC108088.1HDAC1histone deacetylase1115forwardCTGGGGACCTACGGGATATT
reverseGACATGACCGGCTTGAAAAT
Genes of interestNM_001009397GnRHRgonadotropin-releasing hormone receptor150forwardTCTTTGCTGGACCACAGTTAT(14)
reverseGGCAGCTGAAGGTGAAAAAG
U02517GnRHgonadotropin-releasing hormone123forwardGCCCTGGAGGAAAGAGAAAT
reverseGAGGAGAATGGGACTGGTGA
X52488LHBluteinising hormone β-subunit184forwardAGATGCTCCAGGGACTGCT
reverseTGCTTCATGCTGAGGCAGTA
DOI: https://doi.org/10.2478/jvetres-2024-0039 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 451 - 459
Submitted on: Dec 29, 2023
Accepted on: Jul 15, 2024
Published on: Jul 25, 2024
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
anandamide,
indomethacin,
gonadotropin-releasing hormone,
luteinising hormone
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2024 Dorota Tomaszewska-Zaremba, Monika Tomczyk, Karolina Wojtulewicz, Joanna Bochenek, Kinga Pałatyńska, Andrzej Przemysław Herman, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 68 (2024): Issue 3 (September 2024)
Previous article
Next article