Have a personal or library account? Click to login
Development of a recombinant protein-based ELISA for detection of antibodies against bovine herpesvirus 6 (BoHV6) Cover

Development of a recombinant protein-based ELISA for detection of antibodies against bovine herpesvirus 6 (BoHV6)

By: Piotr Kubiś and  Jacek Kuźmak  
Open Access
|Dec 2023

Figures & Tables

Fig. 1.

Electrophoresis in 1% agarose gel of nested PCR amplification products of bovine herpesvirus 6 glycoprotein-coding genes. M – DNA size marker GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Vilnius, Lithuania); NC – negative control; 1 – 1,389 bp fragment of gB gene; 2 – 1,254 bp fragment of gH gene

Fig. 2.

Electrophoresis of purified recombinant gH (48 kDa) and gB (53 kDa) proteins of bovine herpesvirus 6 in 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis in denaturing conditions. M – PageRuler Prestained Protein Ladder molecular weight marker (Thermo Scientific, Vilnius, Lithuania)

Fig. 3.

Western blot detection of recombinant gH (A) and recombinant gB (B) proteins of bovine herpesvirus 6 with bovine serum samples. Lines 1–4 – field positive sera; line 5 – positive control serum; line 6 – negative control serum; lines 7–8 – field negative sera; M – PageRuler Prestained Protein Ladder molecular weight marker (Thermo Scientific, Vilnius, Lithuania)

Fig. 4.

Distribution of sample-to-positive ratio (S/P) values among bovine sera tested for bovine herpesvirus 6 with recombinant glycoprotein B (rgB) antigen

Fig. 5.

Distribution of sample-to-positive ratio (S/P) values among bovine sera tested for bovine herpesvirus 6 with recombinant glycoprotein H (rgH) antigen

Fig. 6.

Scatter plot analysis of ELISA results showing relationship between bovine herpesvirus 6 recombinant gB and recombinant gH (rgB and rgH) antigens. S/P – sample-to-positive ratio

Primers1) used in this study for amplification of bovine herpesvirus 6 DNA fragments

PrimerGenome position2)Primer sequence (5’→3’)Use
gBF35446-35467AACCTTATCCCGTACATGTTTCPCR
gBR37722–37691CAAAGACCAACATGCCGCCAAAPCR
gHF54713–56173GAGTCTGGCTTGAATGACGATCPCR
gHR56021–54767GGGGTCAGTAATGCAGGGCCTAPCR
pL52gBF3)35668–35689GGTTGGGAATTGCAATCTAACATCACGGTGGACCTTAnested PCR, cloning
pL52gBR37056–37036GGAGATGGGAAGTCATTAGCTGCTTAAGCGCTTCTCTTCnested PCR, cloning
pL52gHF54767–54787GGTTGGGAATTGCAATACAAAGTAGACAAAGAAGCTnested PCR, cloning
pL52gHR4)56021–55090GGAGATGGGAAGTCATTATGATTCTTTGTCTACTTTGTAnested PCR, cloning
LICfor55)296–316TAATACGACTCACTATAGGGsequencing, colony PCR
LICrev559–538GAGCGGATAACAATTTCACAGGsequencing, colony PCR
Language: English
Page range: 509 - 515
Submitted on: Oct 8, 2023
|
Accepted on: Dec 5, 2023
|
Published on: Dec 19, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Piotr Kubiś, Jacek Kuźmak, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.