Skip to main content
Have a personal or library account? Click to login
Enterovirus E infects bovine peripheral blood mononuclear cells. Implications for pathogenesis? Cover

Enterovirus E infects bovine peripheral blood mononuclear cells. Implications for pathogenesis?

Journal of Veterinary Research
Volume 67 (2023): Issue 4 (December 2023)
By: ,  ,   and    
Open Access
|Dec 2023
Figures & tables

Figures & Tables

Table 1.

Primer sequences used for the detection of intracellular enterovirus E RNA

PrimerPrimer sequence (5′–3′)Amplicon sizeGenBank accession No.
EV-E802 forwardAAAGGGGGCTGTCGAAACCA802DQ092769.1
EV-E 802 reverseGCTAGTGGGCTCAGACTCCG
EV-E 183 forwardTACGCCTTTCGTGGCTTGGA183
EV-E 183 reverseTTGCTTTTCCTGGCTTGCCG
Table 2.

Monoclonal antibodies used in the study

MarkerExpressed byFluorochromeCloneIsotype
CD4subset of T cellsFITCCC8IgG2a
CD8subset of T cellsAlexa Fluor 647CC63IgG2a
WC1gamma/delta (γδ) T cellsFITCCC15IgG2a
CD21B cellsRPECC51IgG2b
Table 3.

Serum anti-EV-E antibody titres, intracellular viral RNA levels and extracellular virus titres from bovine PBMCs

ParameterIndividual
12345678910
anti-EV-E antibody titer in serumND1:401:201:801:201:401:801:401:201:160
extracellular virus titer (log CCID50/1 mL)3.6251.753.253.1253.8753.1252.1253.6252.753.125
intracellular viral RNA (copy number/μL of RNA)13.3937.481.86649137.13314.823.8525474020.19.610
Table 4.

Enterovirus E effect on the viability and blastogenic response of bovine peripheral blood mononuclear cells to mitogens shown by the MTT reduction assay, n=10

ParameterCEV-E (MOI)
1010.1
viability (%)100
±0		58.928**
±19.969		80.927
±20.681		104.685
±31.217
proliferation ConA (SI)4.332
±0.957		2.198***
±0.731		4.712
±1.274		3.960
±0.779
proliferation LPS (SI) high responders2.085
±0.46		1.479***
±0.152		1.212***
±0.298		1.095***
±0.255
proliferation LPS (SI) low responders0.924
±0.112		1.084
±0.120		0.925
±0.160		0.880
±0.140

1 All data expressed as means values ± standard deviation. EV-E – enterovirus E; C – control (uninfected) cells; MOI – multiplicity of infection; ConA – concanavalin A; LPS – lipopolysaccharide from E. coli; SI – stimulation index.

1 ** – statistically significant difference between control and EV-E-infected cells at P < 0.01;

1 *** – statistically significant difference between control and EV-E infected cells at P < 0.001

Fig. 1.

Representative dot plot cytograms showing distribution of the main lymphocyte subsets of bovine peripheral blood mononuclear cells after 72 h incubation with a high infectious dose of enterovirus E (EV-E): panel (A) unstimulated cells; (B) concanavalin A-stimulated cells; (C) lipopolysaccharide-stimulated cells. In each panel: upper row – control (uninfected) cells, bottom row – EV-E-infected cells; columns from left to right: lymphocyte gating based on their forward and side scatter (FSC/SSC) properties, T-cell gating according to the expression of CD4 and CD8 markers, B-cell gating according to the expression of CD21 marker and gamma-delta-cell gating according to the expression of WC1 marker

Table 5.

Immunophenotyping of bovine peripheral blood lymphocytes cultured for 72 h in the presence of enterovirus E, n = 5

PopulationUnstimulatedLPS-stimulatedConA-stimulated
CEV-E (MOI)CEV-E (MOI)CEV-E (MOI)
1010.11010.11010.1
CD4+CD8−44.80
±8.73		44.86
±6.30		42.98
±6.93		42.46
±7.24		19.38
±3.15		34.55**
±6.53		31.02*
±5.99		38.30***
±5.05		45.98
±10.56		47.48
±9.67		45.30
±7.44		42.24
±7.33
CD4-CD8+22.20
±0.92		20.28
±1.53		21.58
±2.53		22.10
±1.92		12.72
±4.66		23.30*
±5.86		22.22*
±6.17		24.05*
±5.80		13.36
±4.18		19.54
±9.54		13.21
±5.96		14.45
±5.74
CD4+CD8+0.97
±0.38		1.92
±0.88		1.17
±0.40		1.04
±0.18		2.89
±0.61		6.09
±2.16		5.83
±2.61		6.90
±3.27		2.39
±0.68		7.34**
±4.05		2.93
±0.82		2.31
±0.50
CD21+15.38
±8.23		21.96
±6.49		20.30
±8.61		19.59
±8.30		47.86
±9.94		16.39***
±8.63		19.71***
±9.12		11.53***
±5.86		18.55
±6.67		9.49
±4.88		18.46
±5.31		17.66
±9.02
WC1+4.31
±3.01		1.80
±1.40		5.29
±3.66		5.81
±4.57		4.28
±1.94		2.28
±1.48		3.45
±1.78		3.32
±0.99		16.98
±10.99		18.86
±12.10		14.53
±9.16		13.55
±9.18

1 All data expressed as means values ± standard deviation. EVE-E – enterovirus E; C – control (uninfected) cells; MOI – multiplicity of infection; ConA – concanavalin A; LPS – lipopolysaccharide from E. coli.

1* – statistically significant difference between control and EV-E-infected cells at P < 0.05;

1** – statistically significant difference between control and EV-E-infected cells at P < 0.01;

1*** – statistically significant difference between control and EV-E-infected cells at P < 0.001

Table 6.

Cytokine levels in supernatants from bovine peripheral blood mononuclear cells cultured for 72 h in the presence of enterovirus E, n = 5

Cytokine (pg/mL)UnstimulatedLPS-stimulated
CEV-E (MOI)CEV-E (MOI)
1010.11010.1
IL-1β3.56
±2.38		62.09***
±13.39		96.55***
±17.96		24.67*
±5.97		21.81
±6.46		5.35**
±3.81		24.36
±4.95		17.53
±7.21
IL-689.32
±53.37		141.89
±84.48		784.94***
±284.26		864.22***
±82.46		1292.09
±279.69		1209.51
±179.79		1151.45
±167.52		1152.22
±197.26
TNF-α129.09
±84.32		207.14
±90.41		1057.82***
±441.88		1236.32***
±96.40		1780.26
±456.88		2037.78
±550.99		1684.56
±363.51		1682.79
±356.02

1 All data expressed as means values ± standard deviation. EV-E – enterovirus E; C – control (uninfected) cells; MOI – multiplicity of infection; LPS – lipopolysaccharide from E. coli;

1* – statistically significant difference between control and EV-E-infected cells at P < 0.05;

1** – statistically significant difference between control and EV-E-infected cells at P < 0.01;

1*** – statistically significant difference between control and EV-E-infected cells at P < 0.001

Table 7.

Oxidative burst activity of bovine peripheral blood phagocytes after 3 h incubation with enterovirus E, n = 5

Cell typeParameterCEV-E (MOI)
1010.1
granulocytes%91.62 ± 4.392.18 ± 3.9892.94 ± 3.8692.76 ± 4.23
MFI1797.6 ± 269.671774.6 ± 291.221831.4 ± 280.501793.8 ± 286.99
monocytes%43.32 ± 7.7032.62 ± 3.7435.90 ± 6.9437.46 ± 6.65
MFI299.2 ± 87.04208.4 ± 71.53240.2 ± 74.89247.2 ± 93.38

1 All data expressed as means values ± standard deviation. EV-E – enterovirus E; C – control (uninfected) cells; MOI – multiplicity of infection; MFI – mean fluorescence intensity

DOI: https://doi.org/10.2478/jvetres-2023-0061 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Journal RSS Feed
Language: English
Page range: 517 - 527
Submitted on: Jun 2, 2023
Accepted on: Oct 17, 2023
Published on: Dec 19, 2023
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Keywords:
enterovirus E,
bovine PBMCs,
productive infection,
blastogenic response,
pro-inflammatory cytokines
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2023 Joanna Małaczewska, Małgorzata Wróbel, Edyta Kaczorek-Łukowska, Wojciech Rękawek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 67 (2023): Issue 4 (December 2023)
Previous article
Next article