Have a personal or library account? Click to login
Prevalence of the blaCTX-M and blaTEM genes among extended-spectrum beta lactamase–producing Escherichia coli isolated from broiler chickens in Indonesia Cover

Prevalence of the blaCTX-M and blaTEM genes among extended-spectrum beta lactamase–producing Escherichia coli isolated from broiler chickens in Indonesia

Open Access
|Jun 2023

Figures & Tables

Fig. 1.

Appearance of E. coli on eosin methylene blue agar media
Appearance of E. coli on eosin methylene blue agar media

Fig. 2.

The Gram staining appearance of E. coli in microscopy (1000×)
The Gram staining appearance of E. coli in microscopy (1000×)

Fig. 3.

Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime
Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime

Fig. 4.

Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia
Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia

Fig. 5.

Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs
Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs

Fig. 6.

Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs
Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs

The occurrences of E_ coli in broiler cloacal swabs in Blitar district, East Java, Indonesia

SubdistrictFarm numberSample sizeE. coli isolates
Ponggok52828 (100%)
Garum52525 (100%)
Selopuro73636 (100%)
Selorejo52626 (100%)
Total22115115 (100%)

The extended-spectrum beta lactamase–producing E_ coli harbouring blaCTX-M and blaTEM genes

Subdistrict locationEncoding gene
blaCTX-MblaTEM
Ponggok+
++
++
+
++
+
++
+
+
Total9/10; 9/34 (26.5%)4/10; 4/34 (11.8%)
Garum+
+
++
++
Total4/4; 4/34 (11.8%)2/4; 2/34 (5.9%)
Selopuro+
++
+
++
++
+
++
+
Total8/8; 8/34 (23.5%)4/8; 4/34 (11.8%)
Selorejo++
+
+
+
+
++
+
+
+
+
+
+
Total11/12; 11/34 (32.4%)3/12; 3/34 (8.8%)
Overall total32/34 (94.1%)13/34 (38.2%)

The list of primers used in this study

GenePrimerSequencesAmplicon (bp)AnnealingReferences
blaCTX-MForwardCGC TTT GCG ATG TGC AG55054°C(27)
ReverseACC GCG ATA TCG TTG GT
blaTEMForwardATAAAATTCTTGAAGACGAAA1,08059°C(18)
ReverseGACAGTTACCAATGCTTAATC
Language: English
Page range: 179 - 186
Submitted on: Jan 11, 2023
Accepted on: Apr 19, 2023
Published on: Jun 16, 2023
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Hayyun Durrotul Faridah, Freshindy Marissa Wibisono, Freshinta Jellia Wibisono, Nabilatun Nisa, Fatimah Fatimah, Mustofa Helmi Effendi, Emmanuel Nnabuike Ugbo, Aswin Rafif Khairullah, Shendy Canadya Kurniawan, Otto Sahat Martua Silaen, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.