Skip to main content
Have a personal or library account? Click to login
Serum and milk levels of antibodies to bovine viral diarrhoea virus, bovine herpesvirus-1 and -4, and circulation of different bovine herpesvirus-4 genotypes in dairy cattle with clinical mastitis Cover

Serum and milk levels of antibodies to bovine viral diarrhoea virus, bovine herpesvirus-1 and -4, and circulation of different bovine herpesvirus-4 genotypes in dairy cattle with clinical mastitis

Open Access
|Mar 2023

Figures & Tables

Fig. 1

Changes in bovine viral diarrhoea virus (A) and bovine herpesvirus-1 (B) levels between serum and milk samples collected from cattle with clinical mastitis and healthy cattle

Fig. 2

Bland–Altman plot with 95% limit of agreement of serum and milk samples analysed for bovine viral diarrhoea virus expressed as sample/ positive ratio in cattle with clinical mastitis (A) and healthy cattle (B)

Fig. 3

Bland–Altman plot with 95% limit of agreement of serum and milk samples analysed for bovine herpesvirus-1 expressed as percent positivity in cattle with clinical mastitis (A) and healthy cattle (B)

Fig. 4

Bland–Altman plot with 95% limit of agreement of serum and milk samples analysed for bovine herpesvirus-4 expressed as percent positivity in cattle with clinical mastitis

Fig. 5

Phylogenetic tree for the partial gB gene of bovine herpesvirus-4 strains after sequence alignment compared with other sequences deposited in the GenBank database. Bar – number of base substitutions per site

Bovine viral diarrhoea virus (BVDV) and bovine herpesvirus-1 (BoHV-1) levels in serum and milk taken from cattle with clinical mastitis and healthy cattle

P-values
VirusState of healthSerum mean ± SDELISA cut-offMilk mean ± SDELISA cut-offSampleState of healthSample × state of health
Healthy90.24±3.74a,A 80.66±6.99b,A
BVDVMastitic94.71±1.39a,B≥35%93.76±2.87b,B≥0.3<0.0010.0030.156
Healthy90.24±3.74a,A 80.66±6.99b,A
BoHV-1Mastitic94.71±1.39a,B≥35%93.76±2.87b,B≥25%<0.001<0.001<0.001

Primers used in PCR for detection of BoHV-1 and BoHV-4

VirusTarget gene/amplicon size (bp)PrimersSequence (5′–3′)Reference
BoHV-1gC/575PF1CGGCCACGACGCTGACGA(15)
PF2CGCCGCCGAGTACTACCC
BoHV-4gB/615gB1CCCTTCTTTACCACCACCTACA(29)
gB2TGCCATAGCAGAGAAACAATGA

Bovine herpesvirus-4 (BoHV-4) levels in serum and milk samples collected from cattle with clinical mastitis

Sample
SerumMilkELISA cut-offP-value
BoHV-4 positivity rate (%)Mean ± SD110.85 ± 34.39145.64 ± 51.75≥30%<0.001
BoHV-4 positivity degree*Mean ± SD3.15 ± 1.053.97 ± 1.08
Median (min–max)3 (1–5)4 (2–5) <0.001
Language: English
Page range: 33 - 40
Submitted on: Aug 23, 2022
Accepted on: Feb 21, 2023
Published on: Mar 16, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Veysel S. Ataseven, Pınar Ambarcıoğlu, Fırat Doğan, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.