Table 1
Primers and probes used for BCoV, BVDV, BoHV-1 and internal control amplification
| Target | Primer/probe | Sequence (5′–3′) | Amplicon size (bp) | Gene/ protein | Reference |
|---|---|---|---|---|---|
| BCoV-F | CTGGAAGTTGGTGGAGTT | ||||
| BCoV-R | ATTATCGGCCTAACATACATC | 85 | M/matrix | ||
| BCoV | BCoV-Pb | FAM-CCTTCATATCTATACACATCAAGTTGTT-BHQ1 | (6) | ||
| Sp1 | CTTATAAGTGCCCCCAAACTAAAT | ||||
| Sp2 | CCTACTGTGAGATCACATGTTTG | 622 | S/spike | ||
| Pesti-F | CTAGCCATGCCCTTAGTAG | ||||
| Pesti-R | CGTCGAACCAGTGACGACT | ||||
| BVDV | BVDV1 | FAM-TAGCAACAGTGGTGAGTTCGTTGGATGGCT-BHQ1 | 106 | 5′-UTR | (1) |
| BVDV2 | TxR-TAGCGGTAGCAGTGAGTTCGTTGGATGGCC-BHQ1 | ||||
| gD5595-F | CCGCCGTATTTTGAGGAGTCG | ||||
| BoHV-1 | gD5704-R | TCGGTCTCCCCTTCRTCCTC | 46 | gD | (26) |
| BHV1-gD-FAM* | FAM-TCGGTCTCCCCTTCRTCCTC-BHQ1 | ||||
| ACT-1005-F | CAGCACAATGAAGATCAAGATCATC | ||||
| β Actin | ACT-1135-R | CGGACTCATCGTACTCCTGCTT | 130 | bACT | (24) |
| ACT-1081-HEX | HEX-TCGCTGTCCACCTTCCAGCAGATGT- BHQ1 |
Table 2
Univariable analysis of bovine coronavirus (BCoV) seroprevalence in cows and presence of genetic material in nasal swabs (shedding) detected by reverse transcriptase RT-PCR
| Variable | Seroprevalence | RT-PCR positive | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| n/N | % | 95% CI | χ2 | P | n/N | % | 95% CI | χ2 | P | |
| Age group* | 23.20 | <0.001 | 5.06 | 0.080 | ||||||
| ≤ 3 months | 16/89 | 82.0 | 73.9–90.1 | 14/89 | 15.7 | 8.0–23.4 | ||||
| 3–6 months | 102/126 | 81.0 | 74.0–87.9 | 12/126 | 9.5 | 4.3–14.7 | ||||
| ≥ 6 months | 25/51 | 49.0 | 34.8–63.2 | 2/51 | 3.9 | −1.6–9.4 | ||||
| All | 201/261 | 77.0 | 71.4–82.0 | 29/261 | 11.1 | 7.6–15.6 | ||||
| Sex | 0.006 | 0.940 | 2.90 | 0.088 | ||||||
| Female | 89/120 | 74.2 | 65.6–87.1 | 7/120 | 5.8 | 2.4–11.6 | ||||
| Male | 25/34 | 73.5 | 55.6–87.1 | 5/34 | 14.7 | 5.0–31.1 | ||||
| All | 114/154 | 74.0 | 66.4–80.8 | 12/154 | 7.8 | 4.1–13.2 | ||||
| Respiratory signs | 4.39 | 0.0361 | 3.23 | 0.072 | ||||||
| Yes | 62/86 | 72.1 | 61.4–81.2 | 15/86 | 17.4 | 10.1–27.1 | ||||
| No | 57/85 | 67.1 | 56.0–76.9 | 7/85 | 8.2 | 3.4–16.2 | ||||
| All | 119/171 | 69.6 | 62.1–76.4 | 22/171 | 12.9 | 8.2–18.8 | ||||
| BoHV–1 status | 13.97 | <0.001 | 0.084 | 9.772 | ||||||
| Seropositive | 99/117 | 84.6 | 76.8–90.6 | 13/117 | 11.1 | 6.1–18.3 | ||||
| Seronegative | 116/179 | 64.8 | 57.3–71.8 | 18/179 | 10.1 | 6.1–15.4 | ||||
| All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14.5 | ||||
| BVDV status | 5.98 | 0.014 | 1.249 | 0.264 | ||||||
| Seropositive | 113/144 | 78.5 | 70.9–84.9 | 18/144 | 12.5 | 7.6–19.0 | ||||
| Seronegative | 93/142 | 65.5 | 57.1–73.3 | 12/142 | 8.4 | 4.4–14.3 | ||||
| All | 206/286 | 72.0 | 66.4–77.2 | 30/286 | 10.5 | 7.2–14.6 | ||||
| BoHV–1 PCR | 1.142 | 0.285 | 0.35 | 0.554 | ||||||
| Positive | 3/3 | 100.0 | 29.2–100.0 | 0/3 | 0.0 | 0.0–70.8 | ||||
| Negative | 212/293 | 72.3 | 66.9–77.4 | 31/293 | 10.6 | 7.3–14.7 | ||||
| All | 215/296 | 72.6 | 76.2–77.6 | 31/296 | 10.5 | 7.2–14.5 | ||||
| BVDV RT–PCR | 5.107 | 0.024 | 0.04 | 0.841 | ||||||
| Positive | 3/8 | 37.5 | 8.5–75.5 | 1/8 | 12.5 | 0.3–52.7 | ||||
| Negative | 212/288 | 73.6 | 68.1–78.6 | 30/288 | 10.4 | 7.1–14.5 | ||||
| All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14/5 | ||||
| BCoV RT–PCR | 0.042 | 0.837 | ||||||||
| Positive | 23/31 | 74.2 | 55.4–88.1 | |||||||
| Negative | 192/265 | 72.4 | 66.7–77.7 | |||||||
| All | 215/296 | 72.6 | 67.2–77.6 | |||||||
| Herd size* | 29.34 | <0.001 | 10.35 | 0.006 | ||||||
| Smaller (≤77) | 31/62 | 50.0 | 6.0–62.8 | 1/62 | 1.6 | −1.6–4.8 | ||||
| Medium (80–590) | 128/158 | 81.0 | 74.8–87.2 | 19/158 | 12.0 | 6.9–17.1 | ||||
| Larger (≥750) | 24/25 | 96.0 | 87.7–104.2 | 6/25 | 24.0 | 6.0–42.0 | ||||
| All | 183/245 | 74.7 | 69.1–80.3 | 25/245 | 10.2 | 6.7–14.8 | ||||
| Province | 12.65 | 0.013 | 13.04 | 0.011 | ||||||
| Mazowieckie | 44/66 | 66.7 | 54.0–77.8 | 9/66 | 13.6 | 6.4–24.3 | ||||
| Pomorskie | 42/60 | 70.0 | 56.8–81.1 | 2/60 | 3.3 | 0.4–11.5 | ||||
| Opolskie | 58/70 | 82.8 | 71.9–90.8 | 5/70 | 7.1 | 2.4–15.9 | ||||
| Podlaskie | 38/45 | 84.4 | 70.5–93.5 | 3/45 | 6.7 | 1.4–18.3 | ||||
| Wielkopolskie | 33/55 | 60.0 | 46.0–73.0 | 12/55 | 21.8 | 11.8–35.0 | ||||
| All | 215/296 | 72.6 | 67.2–77.6 | 31/296 | 10.5 | 7.2–14.5 | ||||
Table 3
The final generalised linear mixed model presenting risk factors of bovine coronavirus seropositivity in cattle (number of observations = 229)
| Variable | Category | Odds ratio | β (SE) | z | P > |z| | 95% CI |
|---|---|---|---|---|---|---|
| Age group* | ||||||
| ≤3 months | reference | |||||
| 3–6 months | 0.58 | 0.32 | −0.99 | 0.323 | 0.19–1.72 | |
| ≥6 months | 0.27 | 0.14 | −2.44 | 0.015 | 0.10–0.78 | |
| Herd size* | ||||||
| Smaller (≤77) | reference | |||||
| Medium (80–590) | 5.20 | 2.93 | 2.91 | 0.004 | 1.71–15.72 | |
| Larger (≥750) | 39.90 | 45.78 | 3.21 | 0.001 | 4.21–378.14 | |
| Fixed effect | Variance | β (SE) | 95% CI | |||
| Province | 0.95 | 0.87 | 0.16–5.76 |
Table 4
The final generalised linear mixed model presenting risk factors of bovine coronavirus detection in nasal swabs from individual cattle by reverse transcriptase PCR (number of observations = 229)
| Variable | Category | Odds ratio (OR) | β (SE) | z | P > |z| | 95% CI |
|---|---|---|---|---|---|---|
| Herd size* | ||||||
| Smaller (≤77) | reference | |||||
| Medium (80–590) | 4.22 | 1.92 | 3.16 | 0.004 | 1.73–10.30 | |
| Larger (≥750) | 0.02 | 0.02 | -4.24 | <0.001 | 0.002–0.11 | |
| Fixed effect | Variance | β (SE)c | 95% CI | |||
| Age group | 1.06 | 1.66 | 0.05–23.16 |

Fig. 1
Neighbour-joining phylogenetic tree of sequences obtained in the study (19). The tree was constructed using a 601-nucleotide-long fragment of the gene encoding the spike protein of BCoV. Sequences acquired in this study are marked by black squares. The country and the date of isolation (when available) are included in the brackets next to each sequence res – respiratory isolate; ent – enteric isolate