Have a personal or library account? Click to login
Occurrence of bovine coronavirus and other major respiratory viruses in cattle in Poland Cover

Occurrence of bovine coronavirus and other major respiratory viruses in cattle in Poland

Open Access
|Nov 2022

Figures & Tables

Fig. 1

Neighbour-joining phylogenetic tree of sequences obtained in the study (19). The tree was constructed using a 601-nucleotide-long fragment of the gene encoding the spike protein of BCoV. Sequences acquired in this study are marked by black squares. The country and the date of isolation (when available) are included in the brackets next to each sequence res – respiratory isolate; ent – enteric isolate
Neighbour-joining phylogenetic tree of sequences obtained in the study (19). The tree was constructed using a 601-nucleotide-long fragment of the gene encoding the spike protein of BCoV. Sequences acquired in this study are marked by black squares. The country and the date of isolation (when available) are included in the brackets next to each sequence res – respiratory isolate; ent – enteric isolate

Univariable analysis of bovine coronavirus (BCoV) seroprevalence in cows and presence of genetic material in nasal swabs (shedding) detected by reverse transcriptase RT-PCR

VariableSeroprevalenceRT-PCR positive

n/N%95% CIχ2Pn/N%95% CIχ2P
Age group* 23.20<0.001 5.060.080
≤ 3 months16/8982.073.9–90.1 14/8915.78.0–23.4
3–6 months102/12681.074.0–87.9 12/1269.54.3–14.7
≥ 6 months25/5149.034.8–63.2 2/513.9−1.6–9.4
All201/26177.071.4–82.0 29/26111.17.6–15.6
Sex 0.0060.940 2.900.088
Female89/12074.265.6–87.1 7/1205.82.4–11.6
Male25/3473.555.6–87.1 5/3414.75.0–31.1
All114/15474.066.4–80.8 12/1547.84.1–13.2
Respiratory signs 4.390.0361 3.230.072
Yes62/8672.161.4–81.2 15/8617.410.1–27.1
No57/8567.156.0–76.9 7/858.23.4–16.2
All119/17169.662.1–76.4 22/17112.98.2–18.8
BoHV–1 status 13.97<0.001 0.0849.772
Seropositive99/11784.676.8–90.6 13/11711.16.1–18.3
Seronegative116/17964.857.3–71.8 18/17910.16.1–15.4
All215/29672.667.2–77.6 31/29610.57.2–14.5
BVDV status 5.980.014 1.2490.264
Seropositive113/14478.570.9–84.9 18/14412.57.6–19.0
Seronegative93/14265.557.1–73.3 12/1428.44.4–14.3
All206/28672.066.4–77.2 30/28610.57.2–14.6
BoHV–1 PCR 1.1420.285 0.350.554
Positive3/3100.029.2–100.0 0/30.00.0–70.8
Negative212/29372.366.9–77.4 31/29310.67.3–14.7
All215/29672.676.2–77.6 31/29610.57.2–14.5
BVDV RT–PCR 5.1070.024 0.040.841
Positive3/837.58.5–75.5 1/812.50.3–52.7
Negative212/28873.668.1–78.6 30/28810.47.1–14.5
All215/29672.667.2–77.6 31/29610.57.2–14/5
BCoV RT–PCR 0.0420.837
Positive23/3174.255.4–88.1
Negative192/26572.466.7–77.7
All215/29672.667.2–77.6
Herd size* 29.34<0.001 10.350.006
Smaller (≤77)31/6250.06.0–62.8 1/621.6−1.6–4.8
Medium (80–590)128/15881.074.8–87.2 19/15812.06.9–17.1
Larger (≥750)24/2596.087.7–104.2 6/2524.06.0–42.0
All183/24574.769.1–80.3 25/24510.26.7–14.8
Province 12.650.013 13.040.011
Mazowieckie44/6666.754.0–77.8 9/6613.66.4–24.3
Pomorskie42/6070.056.8–81.1 2/603.30.4–11.5
Opolskie58/7082.871.9–90.8 5/707.12.4–15.9
Podlaskie38/4584.470.5–93.5 3/456.71.4–18.3
Wielkopolskie33/5560.046.0–73.0 12/5521.811.8–35.0
All215/29672.667.2–77.6 31/29610.57.2–14.5

The final generalised linear mixed model presenting risk factors of bovine coronavirus detection in nasal swabs from individual cattle by reverse transcriptase PCR (number of observations = 229)

VariableCategoryOdds ratio (OR)β (SE)zP > |z|95% CI
Herd size*
Smaller (≤77)reference
Medium (80–590)4.221.923.160.0041.73–10.30
Larger (≥750)0.020.02-4.24<0.0010.002–0.11

Fixed effect Varianceβ (SE)c95% CI
Age group1.061.660.05–23.16

Primers and probes used for BCoV, BVDV, BoHV-1 and internal control amplification

TargetPrimer/probeSequence (5′–3′)Amplicon size (bp)Gene/ proteinReference
BCoV-FCTGGAAGTTGGTGGAGTT
BCoV-RATTATCGGCCTAACATACATC85M/matrix
BCoVBCoV-PbFAM-CCTTCATATCTATACACATCAAGTTGTT-BHQ1 (6)
Sp1CTTATAAGTGCCCCCAAACTAAAT
Sp2CCTACTGTGAGATCACATGTTTG622S/spike

Pesti-FCTAGCCATGCCCTTAGTAG
Pesti-RCGTCGAACCAGTGACGACT
BVDVBVDV1FAM-TAGCAACAGTGGTGAGTTCGTTGGATGGCT-BHQ11065′-UTR(1)
BVDV2TxR-TAGCGGTAGCAGTGAGTTCGTTGGATGGCC-BHQ1

gD5595-FCCGCCGTATTTTGAGGAGTCG
BoHV-1gD5704-RTCGGTCTCCCCTTCRTCCTC46gD(26)
BHV1-gD-FAM*FAM-TCGGTCTCCCCTTCRTCCTC-BHQ1

ACT-1005-FCAGCACAATGAAGATCAAGATCATC
β ActinACT-1135-RCGGACTCATCGTACTCCTGCTT130bACT(24)
ACT-1081-HEXHEX-TCGCTGTCCACCTTCCAGCAGATGT- BHQ1

The final generalised linear mixed model presenting risk factors of bovine coronavirus seropositivity in cattle (number of observations = 229)

VariableCategoryOdds ratioβ (SE)zP > |z|95% CI
Age group*
≤3 monthsreference
3–6 months0.580.32−0.990.3230.19–1.72
≥6 months0.270.14−2.440.0150.10–0.78
Herd size*
Smaller (≤77)reference
Medium (80–590)5.202.932.910.0041.71–15.72
Larger (≥750)39.9045.783.210.0014.21–378.14

Fixed effect Varianceβ (SE)95% CI
Province0.950.870.16–5.76
Language: English
Page range: 479 - 486
Submitted on: Jun 3, 2022
|
Accepted on: Oct 19, 2022
|
Published on: Nov 4, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Wojciech Socha, Magdalena Larska, Jerzy Rola, Dariusz Bednarek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.