Antimicrobial resistance and virulence genes in staphylococci isolated from aviary capercaillies and free-living birds in south-eastern Poland

Bird species	Total examined animals	Heart	Liver	Spleen	Tarsal joint	Conjunctiva	Palatal fissure	Yolk sac	Dead embryo
Capercaillie (Tetrao urogallus)	73	5	5	9	4	5	7	9	13
White stork (Ciconia ciconia)	35	3	3	5	3	7	6	-	-
Common pheasant(Phasianus colchicus)	46	1	3	6	1	5	4	2	-
Tawny owl (Strix aluco)	10	-	1	2	-	1	2	-	-
Common kestrel (Falco tinnunculus)	8	1	-	2	-	-	2	-	-
Common blackbird (Turdus merula)	7	-	-	-	1	1	2	-	-
Mute swan (Cygnus olor)	5	-	1	-	-	1	1	-	-
Song thrush (Turdus philomenos)	5	-	-	1	-	-	2	-	-
Grey heron (Ardea cinerea)	2	-	1	-	-	-	-	-	-
Great spotted woodpecker (Dendrocopos major)	4	-	-	1	-	-	-	-	-
Common buzzard (Buteo buteo)	3	-	-	-	-	-	-	-	-
Black grouse (Lyrurus tetrix)	2	-	-	-	-	-	-	-	-
Common swift (Apus apus)	4	-	-	-	-	-	-	-	-
Meadow pipit (Anthus pratensis)	5	-	-	-	-	-	-	-	-
Fieldfare (Turdus pilaris)	4	-	-	-	-	-	-	-	-
Lesser spotted eagle (Clanga pomarina)	1	-	-	-	-	-	-	-	-
Total	214	10	14	26	9	20	26	11	13

Table 2

Nucleotide sequences and sizes of PCR products of amplified genes

Gene	Oligonucleotide sequence (5′-3′)	Amplicon size (bp)	PCR conditions	Reference
mecA	AAAATCGATGGTAAAGGTTGGC AGTTCTGGCACTACCGGATTTGC	533	94℃, 5 min, 40 cycles of 94℃ for 1 min, 58℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 5 min	(23)
mecC	GAA AAA AAG GCT TAG AAC GCC TC GAA GAT CTT TTC CGT TTT CAG C	138	94℃, 15 min, 30 cycles of 94℃ for 30 s, 59℃ for 1 min, 72℃ for 1 min, final extension for 10 min	(35)
blaZ ermA	ACTTCAACACCTGCTGCTTTC TAGGTTCAGATTGGCCCTTAG TCT AAAAAG CATGTAAAAGAA TGA TTATAATTATTT GATAGC TTC	173 645	95℃, 3 min, 30 cycles of 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, final extension 72℃ for 4 min	(7)
ermB	TAACGACGAAACTGGCTAAAA ATCTGTGGTATGGCGGGTAAG	416	95℃, 3 min, 30 cycles of 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, final extension 72℃ for 5 min	(36)
ermC	TAATCGTGGAATACGGGTTTG AATCGTCAATTCCTGCATGT	299
tetK	GTAGCGACAATAGGTAATAGT GTAGTGACAATAAACCTCCTA	360
tetM	CATATGTCCTGGCGTGTCTA AGTGGAGCGATTACAGAA	158	94℃, 5 min, 30 cycles of 94℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min,	(18)
tetL	ATAAATTGTTTCGGGTCGGTAAT AACCAGCCAACTAATGACAATGAT	1077	final extension 72℃ for 5 min
tetO	AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA	514
msrA/B	GCAAATGGTGTAGGTAAGACAACT ATCATGTGATGTAAACAAAAT	399	95℃, 3 min, 35 cycles of 93℃ for 30 s, 55℃ for 2 min, 74℃ for 1 min, final extension 72℃ 90 s	(36)
Aac(6′)/aph(2ʺ)	CAGAGCCTTGGGAAGATGAAG CCTCGTGTAATTCATGTTCTGGC	348	94℃, 10 min, 35 cycles of 94℃ for 45 s, 60℃ for 60 s, 72℃ for 60 s, final extension cycle 72℃ for 5 min	(39)
norA	TTTGTTTTCAGTGTCAGAATTTATGTTTG GGCTTGGTGAAATATCAGCTATTAAAC	140	94℃, 5 min, 30 cycles of 94℃ for 30 s, 60℃ for 30 s, 72℃ for 60 s, final extension 72℃ for 5 min	(26)
cfr	TGA AGT ATA AAG CAG GTT GGG AGT CA ACC ATA TAA TTG ACC ACA AGC AGC	746	94℃, 2 min, 30 cycles of 94℃ for 30 s, 45℃ for 30 s, and 72℃ for 45 s, final extension 72℃ for 1 min	(13)
mphC	GAG ACT ACC AAG AAG ACC TGA CG CAT ACG CCG ATT CTC CTG AT	530	95℃, 5 min, 35 cycles of 94℃ for 1 min, 59℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 1 min	(16)
sea	TGCATGTTTTCAGAGTTAATC ACGATCAATTTTTACAGC	544
seb	TCTTTGTCGTAAGATAAACTTC GAATGATATTAATTCGCATC	416	94℃, 5 min, 35 cycles of 94℃ for 2 min, 57℃ for 2 min, 72℃ for 1 min,	(22)
sec	GACATAAAAGCTAGGAATTT AAATCGGATTAACATTATCCA	257	final extension 72℃ for 7 min
sed	TTACTAGTTTGGTAATATCTCCTT CCACCATAACAATTAATGC	334
see	ATAGATAAAGTTAAAACAAGCAA TAACTTACCGTGGACCC	170
tst	ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC	326
pvl	ATCATTAGGTAAAATGTCTGGACATGATCCA GCATCAASTGTATTGGATAGCAAAAGC	433	95℃, 5 min, 30 cycles of 94℃ for 1 min, 55℃ for 30 s, 72℃ for 1 min,	(38)
eta	GCAGGTGTTGATTTAGCATT AGATGTCCCTATTTTTGCTG	93	final extension at 72℃ for 5 min
etb	ACAAGCAAAAGAATACAGCG GTTTTTGGCTGCTTCTCTTG	226

Table 3

Phenotypic antimicrobial resistance of Staphylococcus strains

	Antibiotic
Species		AML25	AMC30	AMP10	P10	FOX30	DA2	C30	E15	CN10	TE30	SXT25	ENR5	FD5
S. sciuri, n = 56	R	15	8	18	16	14	2	2	-	1	15	3	26	28
	I	-	-	-	-	-	12	-	5	1	1	-	-	-
S. xylosus, n = 14	R	3	2	3	3	1	-	2	4	-	6	2	6	6
	I	-	-	-	-	-	1	1	2	-	-	-	-	-
S. equorum, n = 12	R	1	-	1	1	1	1	2	2	-	3	1	1	2
	I	-	-	-	-	-	-	-	3	1	-	-	-	-
S. saprophyticus, n = 8	R	-	1	2	1	-	-	-	5	-	7	2	5	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. aureus, n = 6	R	1	4	4	4	-	-	-	-	-	-	-	3	1
	I	-	-	-	-	-	3	-	4	-	-	-	-	-
S. epidermidis, n = 6	R	1	1	4	3	-	3	-	4	-	4	5	5	-
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. cohnii, n = 6	R	3	1	3	2	3	2	-	3	-	3	2	3	2
	I	-	-	-	-	-	1	-	2	1	-	-	-	-
S. pseudintermedius, n = 3	R	1	1	1	1	-	1	1	1	-	1	-	1	-
	I	-	-	-	-	-	-	-	1	-	-	-	-	-
S. haemolyticus, n = 3	R	1	-	2	2	1	1	-	1	1	1	2	1	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. lentus, n = 3	R	-	-	-	-	-	-	-	-	-	1	-	1	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. kloosii, n = 2	R	-	-	1	-	-	-	-	-	-	1	-	-	1
	I	-	-	-	-	-	-	-	1	-	-	-	-	-
S. succinus, n = 2	R	-	-	-	-	-	-	-	1	-	-	-	-	-
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. vitulinus, n = 2	R	-	1	1	1	1	-	-	1	-	-	-	1	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. condimenti, n =1	R	1	-	1	1	1	1	1	-	-	-	-	1	1
	I	-	-	-	-	-	-	-	1	1	1	1	-	-
S. nepalensis, n = 1	R	-	-	-	-	-	-	-	-	-	1	-	1	-
	I	-	-	-	-	-	-	1	-	-	-	-	-	-
S. arlettae, n = 1	R	-	-	-	1	-	-	-	1	-	1-		1	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. pasteuri, n = 1	R	-	-	1	-	-	-	-	-	-	-	-	-	-
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. chromogenes, n = 1	R	1	1	1	1	1	1	-	1	-	1	1	1	1
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
S. warneri, n = 1	R	-	-	-	-	-	-	-	-	-	-	-	-	-
	I	-	-	-	-	-	-	-	-	-	-	-	-	-
Total number		28	20	43	37	23	29	9	43	6	47	19	57	47
%		21.7	15.5	33.3	28.7	17.8	22.5	7.0	33.3	4.7	36.4	14.7	44.2	36.4

[i] AML25 – amoxicillin 25 μg; AMC30 – amoxicillin + clavulanic acid 20 + 10 μg; AMP10 – ampicillin 10 μg; P10 – penicillin G 10 units; FOX30 – cefoxitin 30 μg; DA2 – clindamycin 2 μg; C30 – chloramphenicol 30 μg; E15 – erythromycin 15 μg; CN10 – gentamicin 10 μg; TE30 – tetracycline 30 μg; SXT25 – trimethoprim–sulfamethoxazole 1:19, 25 μg; ENR5 – enrofloxacin 5 μg; FD5 – fusidic acid 5 μg

Table 4

Percentage of Staphylococcus strains isolated from individual bird species resistant to specific antibacterial agents

AML25	AMC30	AMP10	P10	FOX30	DA2	C30	E15	CN10	TE30	SXT25	ENR5	FD5
Capercaillie (Tetrao urogallus)	57	12 21%	7 12.3%	21 36.8%	18 31.6%	9 15.8%	23 40.4%	4 7%	19 33.3%	4 7%	14 24.6%	11 19.3%	26 45.6%	20 35.1%
White stork (Ciconia ciconia)	27	5 18.5%	3 11.1%	6 22.2%	5 18.5%	5 18.5%	3 11.1%	2 7.4%	9 33.3%	1 3.7%	12 44.4%	3 11.1%	9 33.3%	12 44.4%
Common pheasant (Phasianus colchicus)	22	10 45.5%	8 36.4%	12 54.5%	11 50.0%	7 31.8%	3 13.6%	3 13.6%	11 50.5%	-	20 90/9%	5 22.7%	18 81.8%	11 50.5%
Tawny owl (Strix aluco)	6	-	-	1 16.7%	-	-	-	-	1 16.7%	-	1 16.7%	-	-	1 16.7%
Common kestrel (Falco tinnunculus)	5	-	-	-	-	-	-	-	20.01 %	-	-	-	20.01 %	20.01 %
Common blackbird (Turdus merula)	4	-	-	-	-	-	-	-	-	-	-	-	-	-
Mute swan (Cygnus olor)	3	1 33.3%	1 33.3%	2 66.6%	2 66.6%	2 66.6%	-	-	-	-	-	-	2 66.6%	1 33.3%
Song thrush (Turdus philomenos)	3	-	1 33.3%	1 33.3%	1 33.3%	-	-	-	1 33.3%	-	-	-	1 33.3%	1 33.3%
Grey heron (Ardea cinerea)	1	-	-	-	-	-	-	-	1 100%	1 100%	-	-	-	-
Great spotted woodpecker (Dendrocopus major)	1	-	-	-	-	-	-	-	-	-	-	-	-	-

[i] AML25 – amoxicillin 25 μg; AMC30 – amoxicillin+clavulanic acid 20 + 10 μg; AMP10 – ampicillin 10 μg; P10 – penicillin G 10 units; FOX30 – cefoxitin 30 μg; DA2 – clindamycin 2 μg; C30 – chloramphenicol 30 μg; E15 – erythromycin 15 μg; CN10 – gentamicin 10 μg; TE30 – tetracycline 30 μg; SXT25 – trimethoprim–sulfamethoxazole 1:19, 25 μg; ENR5 – enrofloxacin 5 μg; FD5 – fusidic acid 5 μg. The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates

Table 5

Multidrug resistance profiles of isolated Staphylococcus strains

Species of bird	Number of Staphylococcus (% strains of all isolated strains)	Phenotypic resistance combination pattern (number of classes of antimicrobial agents)	Number of strains
		no resistance	10
		β-lactams (1)	6
		macrolides (1)	7
		fusidic acid (1)	6
		fluoroquinolones (1)	1
		fusidic acid, fluoroquinolones (2)	5
		phenicols, tetracyclines (2)	1
		fluoroquinolones, β-lactams (2)	1
		fluoroquinolones, fusidic acid, β-lactams (3)	2
		fluoroquinolones, macrolides, β-lactams (3)	2
		macrolides, β-lactams, tetracyclines (3)	2
		fluoroquinolones, fusidic acid, tetracyclines (3)	1
Capercaillie		fluoroquinolones, fusidic acid, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4)	1
(Tetrao urogallus)	57 (44.2)	fluoroquinolones, tetracyclines, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fluoroquinolones, fusidic acid, β-lactams, tetracyclines (4)	1
		fluoroquinolones, fusidic acid, β-lactams, macrolides (4)	1
		fluoroquinolones, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fluoroquinolones, macrolides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fluoroquinolones, aminoglycosides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (5)	1
		fluoroquinolones, macrolides, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5)	2
		fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, sulfonamide + dihydrofolate reductase inhibitor (6)	1
		fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, tetracyclines, phenicols, sulfonamide + dihydrofolate reductase inhibitor (8)	2
		no resistance	7
		β-lactams (1)	1
		macrolides (1)	1
		tetracyclines (1)	2
		sulfonamide + dihydrofolate reductase inhibitor (1)	1
		macrolides, tetracyclines (2)	2
		Fusidic acid, tetracyclines (2)	3
		Fusidic acid, fluoroquinolones (2)	1
		macrolides, β-lactams (2)	1
White stork (Ciconia ciconia)	27 (20.9)	fusidic acid, fluoroquinolones, tetracyclines (3) fusidic acid, fluoroquinolones, β-lactams (3)	1 1
		fusidic acid, fluoroquinolones, β-lactams, macrolides (4)	1
		fusidic acid, fluoroquinolones, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines (5)	1
		fusidic acid, fluoroquinolones, macrolides, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5)	1
		fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (6)	1
		fusidic acid, fluoroquinolones, aminoglycosides, β-lactams, tetracyclines, phenicols (6)	1
		no resistance	1
		phenicols (1)	1
		β-lactams, tetracyclines (2)	1
		fluoroquinolones, macrolides, tetracyclines (3)	4
		macrolides, β-lactams, tetracyclines (3)	1
		fluoroquinolones, β-lactams, tetracyclines (3)	1
		fluoroquinolones, macrolides, fusidic acid, tetracyclines (4)	2
		fluoroquinolones, β-lactams, fusidic acid, tetracyclines (4)	4
Common pheasant		fluoroquinolones, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4)	1
(Phasianus colchicus)	22 (17.1)	fluoroquinolones, fusidic acid, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4)	1
		fluoroquinolones, β-lactams, tetracyclines, macrolides (4)	1
		fluoroquinolones, fusidic acid, tetracyclines, macrolides, phenicols (5)	1
		fluoroquinolones, fusidic acid, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5)	1
		fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (6)	1
		fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, phenicols, sulfonamide + dihydrofolate reductase inhibitor (7)	1
Tawny owl		no resistance	4
	6 (4.6)	β-lactams (1)	1
(Strix aluco)		macrolides, fusidic acid, tetracyclines (3)	1
Common kestrel	5 (3.9)	no resistance	4
(Falco tinnunculus)		fluoroquinolones, fusidic acid, macrolides (3)	1
Common blackbird (Turdus merula)	4 (3.1)	no resistance	4
		no resistance	1
Mute swan	3 (2.3)	fluoroquinolones, β-lactams (2)	1
(Cygnus olor)		fluoroquinolones, β-lactams, fusidic acid (3)	1
Song thrush		no resistance	1
(Turdus	3 (2.3)	fluoroquinolones, fusidic acid (2)	1
philomelos)		β-lactams, macrolides (2)	1
Grey heron (Ardea cinerea)	1 (0.8)	macrolides, aminoglycosides (2)	1
Great spotted woodpecker (Dendrocopos major)	1 (0.8)	no resistance	1

Table 6

Presence of genes encoding resistance to antimicrobial agents and staphylococcal toxins in isolated strains

Gene	S. sci (n=56)	S. xyl (n=14)	S. equ (n=12)	S. sap (n=8)	S. aur (n=6)	S. epi (n=6)	S. coh (n=6)	S. pse (n=3)	S. hae (n=3)	S. len (n=3)	S. klo (n=2)	S. suc (n=2)	S. vit (n=2)	S. con (n=1)	S. nep (n=1)	S. arl (n=1)	S. pas (n=1)	S. chr (n=1)	Total	%
mecA	7						1						1						9	7.0
mecC
blaZ	2	3		2	4	2		1									1	1	16	12.4
msrA/B	3	2	3	3		1	1	2	1							1			17	13.2
ermA	5												1						6	4.7
ermB	12	1	2	1			2	2								1			21	16.3
ermC	7	3	5	1		5	3	1	1			1							27	20.9
tetK	19	5	4	5	2	4	4	2		2	1				1				49	38.0
tetM	16	7	5	3	3	1		1		1		1			1	1			40	31.0
tetL	5						1		1										7	5.4
tetO	3	1	1					1						1					7	5.4
cfr		1		1			1			1					1				5	3.9
norA	6	2	1	1	6	2	1	1											20	15.5
aac(6′)/ aph(2ʺ)		3	1				1		1	1									7	5.4
mphC	7	5		3	2	2	2		1			1							23	17.8
sea		1			1		1												3	2.3
seb
sec
sed
see
pvl
eta
etb
tst	1																		1	0.8
																			129

[i] S. sci – Staphylococcus sciuri; S. xyl – Staphylococcus xylosus; S. equ – Staphylococcus equorum; S. sap – Staphylococcus saprophyticus; S. aur – Staphylococcus aureus; S. epi – Staphylococcus epidermidis; S. coh – Staphylococcus cohnii; S pse – Staphylococcus pseudintermedius; S. hae – Staphylococcus haemolyticus; S. len – Staphylococcus lentus; S. klo – Staphylococcus kloosii; S. suc – Staphylococcus succinus; S. vit – Staphylococcus vitulinus; S. con – Staphylococcus condimenti; S. nep – Staphylococcus nepalensis; S. arl – Staphylococcus arlettae; S. pas – Staphylococcus pasteuri; S. chr – Staphylococcus chromogenes; S. war – Staphylococcus warneri

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/jvetres-2022-0050 | Journal eISSN: 2450-8608 (formerly 2300-3235)

Journal RSS Feed

Language: English

Page range: 361 - 372

Submitted on: Mar 23, 2022

Accepted on: Sep 7, 2022

Published on: Sep 15, 2022

Published by: National Veterinary Research Institute in Pulawy

In partnership with: Paradigm Publishing Services

Keywords:

Tetrao urogallus,

free-living birds,

methicillin-resistant Staphylococcus,

antimicrobial resistance genes,

enterotoxigenicity,

toxic shock syndrome toxin

Related subjects:

Life sciences,

Molecular biology,

Microbiology and virology,

Life sciences, other,

Medicine,

Veterinary medicine

© 2022 Magdalena Sulikowska, Agnieszka Marek, Łukasz Jarosz, Dagmara Stępień-Pyśniak, Renata Urban-Chmiel, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 66 (2022): Issue 3 (September 2022)