Skip to main content
Have a personal or library account? Click to login
Protective effects of Bacillus subtilis fermentation extract against ochratoxin A-induced nephrotoxicity and immunotoxicity in broiler chickens Cover

Protective effects of Bacillus subtilis fermentation extract against ochratoxin A-induced nephrotoxicity and immunotoxicity in broiler chickens

Open Access
|Jul 2022

Figures & Tables

Table 1

The primer sequences used in gene expression analysis

PrimerSequenceAccession numberAmplicon size (bp)
Bcl-2F: TTCAAGCGAAAACAGGGTGG
R: CTCTGAGCACATGGAAAGCC
NM_205339.2167
BaxF: CACCTTTGTCTCACCTGTGC
R: GATGGCAGTGATGAGCATGG
XM_015290060.2241
CASP-3F: TTGAAGCAGACAGTGGACCA
R: GTTCAAGTTTCCTGGCGTGT
NM_204725.1177
β-actinF: CCCACACCCCTGTGATGAAAR:
TAGAACTTTGGGGGCGTTCG
NM_205518.1177

[i] Bcl-2 – B-cell protein 2; Bax – Bcl-2-associated x protein; CASP-3 – caspase 3

Fig. 1

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the specific antibody titres 21 days after vaccination (n = 5 birds/group)

* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Fig. 2

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on swelling of the toe web skin 21 days after phytohaemagglutinin-P injection (n = 5 birds/group)

* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Fig. 3

Analysis of serum metabolic wastes in chickens after exposure to ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) (n = 5 birds/group)

CRE – creatinine; UA – uric acid; BUN – blood urea nitrogen; * – P < 0.05 versus control group; ^ – P <0.05 versus OTA group

Fig. 4

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the levels of oxidative and antioxidative parameters in the kidney and immune tissues (n = 5 birds/group)

MDA – malondialdehyde; CAT – catalase; GSH – glutathione; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Table 2

Ochratoxin A levels in serum and tissues

SampleControlOTABSFEOTA + BSFE
Serum (μg/L)< LOD111.3 ± 1.7< LOD6.6 ± 1.37 ^
Kidney (μg/Kg)< LOD26.67 ± 6.03< LOD12.3 ± 4.36 ^
Liver (μg/Kg)< LOD14.83 ± 2.84< LOD5.25 ± 1.52 ^
Muscle (μg/Kg)< LOD8.77 ± 1.97< LOD2.9 ± 0.85 ^

[i] OTA – ochratoxin A; BSFE - Bacillus subtilis fermentation extract; LOD – limit of detection; ^ – P < 0.05 versus ochratoxin A (OTA) group; 1– LOD was 1 μg/kg and 1 μg/L. Values are presented as mean ± SD (n = 3 birds/group)

Fig. 5

Photomicrograph of kidney tissue sections stained by haematoxylin and eosin. a – control group with normal histological structure; b–d – ochratoxin A (OTA) group showing vacuolar degeneration (black arrows), necrosis (blue arrow) and desquamation (red arrows) of tubular epithelium, tubular and interstitial inflammatory cell infiltration (black triangles) and interstitial haemorrhage (black stars); e–f – Bacillus subtilis fermentation extract + OTA group showing moderate vacuolar degeneration (black arrows) in some tubular epithelial cells and mild interstitial inflammatory cell infiltration (black triangles)

Fig. 6

Photomicrograph of spleen (a–d) and thymus (e–h) tissue sections stained by haematoxylin and eosin. a and e – control group with normal histological structure; b and f, c and g – ochratoxin A (OTA) group showing lymphocytic cell depletion and lymphocytolysis (black triangles), multifocal areas of necrosis (circles), thinning in the cortical layer (black arrow) and expansion with extensive necrosis of medulla (black star); d and h – Bacillus subtilis fermentation extract + OTA group showing normal histological structure

Fig. 7

Photomicrograph of bursal tissue sections stained by haematoxylin and eosin. a – control group with normal histological architecture; b–d – ochratoxin A (OTA) group showing lymphocytic cell necrosis with large number of phagocytic cells (black triangles), interstitial widening by fibrinous exudate and inflammatory cell infiltration (black stars) and atrophy of the lobules with extensive corrugation of the basement membrane (black arrows); e and f – Bacillus subtilis fermentation extract + OTA group showing mild medullary lymphocytolysis (black triangles) and widening of the interfollicular septa by oedema and infiltration by a few inflammatory cells (black star)

Table 3

Microscopic lesion scoring of the examined organs in different groups

LesionControlOTABSFEOTA + BSFE
Microscopic renal lesion scoring
RTD0 a5 b0 a3 c
RTN0 a5 b0 a3 c
RTP0 a3 b0 a2 c
Inflammation0 a5 b0 a1 c
Haemorrhaging0 a2 b0 a1 c
Congestion0 a3 c1 b1 b
Glomerular hypercellularity0 a3 b0 a0 a
Glomerular degeneration0 a4 b0 a2 c
Microscopic splenic lesion scoring
Lymphocytolysis0 a3 b0 a0 a
Congestion0 a3 b0 a1 c
Microscopic thymic lesion scoring
Lymphocytolysis0 a4 b0 a0 a
Congestion0 a2 b0 a0 a
Microscopic bursal lesion scoring
Lymphocytolysis0 a5 b0 a1 c
Congestion0 a2 b0 a0 a
0 a4 b0 a0 a

[i] OTA – ochratoxin A; BSFE – Bacillus subtilis fermentation extract; RTD – renal tubular degeneration; RTN – renal tubular necrosis; RTP – renal tubular proliferation. Data are presented as median (n = 7 microscopic field/5 sections representing 5 birds/group). Different letters in the same column indicate a significant difference at P < 0.05

Fig. 8

Impacts of ochratoxin A (OTA) and/ or Bacillus subtilis fermentation extract (BSFE) on gene expression levels of apoptosis-related genes in different tissues of broiler chickens (n = 3 birds/ group)

BCL-2 – B-cell lymphoma 2 protein; BAX – BCL-2-associated X protein; CASP-3 – caspase 3; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

DOI: https://doi.org/10.2478/jvetres-2022-0030 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 167 - 177
Submitted on: Jan 27, 2022
Accepted on: May 31, 2022
Published on: Jul 5, 2022
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2022 Mohamed A. Elhady, Abdel Azeim A. Khalaf, Marwa A. Ibrahim, Eman I. Hassanen, Rehab E. Abdelrahman, Peter A. Noshy, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.