Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated
| Mammal order | Species | Scientific name | Origin | Main diet | Scavenging habit** | Individuals (n) | Isolates (n) |
|---|---|---|---|---|---|---|---|
| Artiodactyla | Iberian ibex | Capra pyrenaica | CWFR-LA | Herbivorous | No | 1 | 0 |
| Mouflon | Ovis orientalis | Hunting | Herbivorous | No | 4 | 4 | |
| Red deer | Cervus elaphus | Hunting | Herbivorous | No | 9 | 10 | |
| Roe deer | Capreolus capreolus | CWFR-LA | Herbivorous | No | 1 | 2 | |
| Wild boar | Sus scrofa | Hunting | Omnivorous | No | 17 | 16 | |
| Total | 32 | 32 | |||||
| Carnivora | American mink | Neovison vison | CWFR-LA | Carnivorous | Yes | 6 | 11 |
| Badger | Meles meles | CWFR-LA | Omnivorous | Yes | 3 | 6 | |
| Beech marten | Martes foina | CWFR-LA | Carnivorous | Yes | 2 | 4 | |
| Common genet | Genetta genetta | CWFR-LA | Carnivorous | Yes | 1 | 2 | |
| Common otter* | Lutra lutra | CWFR-LA | Piscivorous | Yes | 3 | 8 | |
| Red fox | Vulpes vulpes | CWFR-LA | Carnivorous | Yes | 3 | 3 | |
| Weasel | Mustela nivalis | CWFR-LA | Carnivorous | Yes | 1 | 0 | |
| Total | 19 | 34 | |||||
| Chiroptera | European bat free-tailed | Tadarida teniotis | CWFR-LA | Insectivorous | No | 1 | 2 |
| Total | 1 | 2 | |||||
| Erinaceomorpha | Hedgehog | Erinaceus europaeus | CWFR-LA | Insectivorous | No | 11 | 24 |
| Total | 11 | 24 | |||||
| Lagomorpha | Wild rabbit | Oryctolagus cuniculus | Hunting | Herbivorous | No | 38 | 33 |
| Granada hare | Lepus granatensis | Hunting | Herbivorous | No | 2 | 1 | |
| Total | 40 | 34 | |||||
| TOTAL | 16 | 103 | 126 | ||||
Antibiotic resistance of Enterococcus spp_ isolates in relation to sample source and order
| Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
|---|---|---|---|---|
| Source of samples | ERI | CWFR-LA (61) | 21 (34.43) | 0.0149 |
| Hunting (64) | 11 (17.19) | |||
| S | CWFR-LA (61) | 18 (29.51) | 0.0024 | |
| Hunting (64) | 6 (9.38) | |||
| TE | CWFR-LA (61) | 34 (55.74) | 0.0000 | |
| Hunting (64) | 7 (10.94) | |||
| Order | CIP | Artiodactyla (32) | 9 (28.13) | 0.0018 |
| Carnivora (33) | 24 (72.73) | |||
| Erinaceomorpha (24) | 9 (37.50) | |||
| Lagomorpha (34) | 22 (64.71) | |||
| Chiroptera (2) | 1 (50.00) | |||
| TE | Artiodactyla (32) | 5 (15.63) | 0.0000 | |
| Carnivora (33) | 22 (66.67) | |||
| Erinaceomorpha (24) | 10 (41.67) | |||
| Lagomorpha (34) | 4 (11.76) | |||
| Chiroptera (2) | 0 | Not applicable | ||
Frequency of Enterococcus spp_ isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin
| Enterococcus spp. | Isolates (n) | Isolates (%) | Resistance to QD n (%) | |
|---|---|---|---|---|
| Enterococcus faecalis | 47 | 37.60 | 38 (80.85) | |
| Enterococcus casseliflavus | 26 | 20.63 | 8 (30.77) | |
| Enterococcus faecium | 22 | 17.46 | 12 (54.55) | |
| Enterococcus hirae | 13 (−1) | 9.60 | 9 (75.00) | |
| Enterococcus gallinarum | 9 | 7.14 | 5 (55.56) | |
| Enterococcus mundtii | 8 | 6.35 | 6 (75.00) | |
| Enterococcus avium | 1 | 0.79 | 1 (100.00) | |
| TOTAL | 125* | 100 | 79 (63.20) | |
| Species Order | Isolates (n) | Isolates (%) | Resistance to QD n (%) | P value for associations |
| Artiodactyla | 32 | 25.60 | 11 (34.38) | Lag. vs Art. F 0.0000 |
| Carnivora | 33 | 26.40 | 20 (60.61) | Carn. vs Art. 0.0195 |
| Chiroptera | 2 | 1.6 | 2 (100.00) | |
| Erinaceomorpha | 24 | 19.2 | 16 (66.67) | Erin. vs Art. 0.0100 |
| Lagomorpha | 34 | 27.2 | 30 (88.24) | |
| Age | P value for associations | |||
| Adult | 70 | 56.00 | 37 (52.86) | Young vs Adult 0.0052 |
| Young | 50 | 40.00 | 38 (76.00) | |
| Infant | 5 | 4.00 | 4 (80.0) | Not applicable |
| TOTAL | 125* | 100 | 79 (63.20) | |
Results of the statistical analysis of E_ faecalis and E_ faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals
| Factor | Variable (n) | E. faecalis n (%) | E. faecium n (%) | P value* |
|---|---|---|---|---|
| Source of sampling | CWFR-LA (36) | 19 (52.78) | 17 (47.22) | |
| Hunting (33) | 28 (84.85) | 5 (15.15) | 0.0025 | |
| Age | Adult (32) | 15 (46.88) | 17 (53.13) | 0.0009 |
| Young (32) | 27 (84.38) | 5 (15.63) | ||
| Infant (5) | 5 (100.00) | 0 | Not applicable | |
| Sex** | Female (29) | 25 (86.21) | 4 (13.79) | F 0.0078 |
| Male (39) | 22 (56.41 | 17 (43.59) | ||
| Main diet | Carnivorous (15) | 8 (53.33) | 7 (46.67) | 0.0152 |
| Herbivorous (33) | 28 (84.85) | 5 (15.15) | ||
| Scavenging habit | No (48) | 36 (75.00) | 12 (25.00) | |
| Yes (21) | 11 (52.38) | 10 (47.62) | 0.0383 | |
Antibiotic resistance of Enterococcus spp_ isolates in relation to sex, main diet and scavenging habit
| Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
|---|---|---|---|---|
| CIP | Female (48) | 31 (64.58) | 0.0096 | |
| Sex | Male (75) | 32 (42.67) | ||
| Female (48) | 8 (16.67) | |||
| GEN | Male (75) | 3 (4.00) | F 0.0200 | |
| AMP | Carnivorous (20) | 5 (25.00) | F 0.0376 | |
| Herbivorous (50) | 3 (6.00) | |||
| Carnivorous (20) | 16 (80.00) | Carn. vs Omn: F 0.0008 | ||
| Herbivorous (50) | 28 (56.00) | |||
| CIP | Insectivorous (26) | 10 (38.46) | ||
| Main diet | Omnivorous (22) | 6 (27.27) | ||
| Piscivorous (7) | 5 (71.43) | |||
| Carnivorous (20) | 15 (75.00) | Carn. vs Herb. 0.0000 | ||
| TE | Herbivorous (50) | 9 (18.00) | Carn. vs Ins. 0.0084 | |
| Insectivorous (26) | 10 (38.46) | Carn. vs Omn. F 0.0003 | ||
| Omnivorous (22) | 4 (18.18) | Ins. vs Herb. 0.0313 | ||
| AMP | No (92) | 3 (3.26) | F 0.0104 | |
| Yes (33) | 6 (18.18) | |||
| CL | No (92) | 6 (6.52) | 0.0368 | |
| Yes (33) | 6 (18.18) | |||
| No (92) | 41 (44.57) | |||
| Scavenging habit | CIP | Yes (33) | 24 (72.73) | 0.0029 |
| No (92) | 19 (20.65) | |||
| ERI | Yes (33) | 13 (39.39) | 0.0215 | |
| No (92) | 12 (13.04) | |||
| S | Yes (33) | 12 (36.36) | 0.0032 | |
| TE | No (92) | 19 (20.65) | 0.0000 | |
| Yes (33) | 22 (66.67) | |||
Frequency of Enterococcus spp_ isolates resistant to the studied antibiotics by mammal species
| Species | Enterococcus spp. isolates (n) | Enterococcus spp. (%) | Antibiotic tested | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| AMP | CL | CIP | ERI | GEN | QD | S | TE | |||
| American mink | 11 | 8.80 | 3 | 9 | 4 | 2 | 6 | 3 | 8 | |
| Badger | 6 | 4.80 | 1 | 3 | 2 | 1 | 4 | 3 | 4 | |
| Beech marten | 4 | 3.20 | 2 | 2 | 3 | 2 | 1 | 2 | 3 | |
| Common genet | 2 | 1.60 | 2 | 2 | 2 | |||||
| Common otter | 7 | 5.60 | 2 | 5 | 4 | 5 | 3 | 3 | ||
| European free-tailed bat | 2 | 1.60 | 1 | 1 | 2 | |||||
| Granada hare | 1 | 0.80 | 1 | |||||||
| Hedgehog | 24 | 19.20 | 2 | 9 | 6 | 2 | 16 | 4 | 10 | |
| Mouflon | 4 | 3.20 | 1 | 1 | 1 | |||||
| Red deer | 10 | 8.00 | 1 | 4 | 4 | 2 | 3 | |||
| Roe deer | 2 | 1.60 | 1 | 1 | 2 | 1 | 2 | 2 | 2 | |
| Red fox | 3 | 2.40 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | |
| Wild boar | 16 | 12.80 | 3 | 1 | 7 | |||||
| Wild rabbit | 33 | 26.40 | 1 | 2 | 22 | 6 | 5 | 29 | 6 | 4 |
| TOTAL N | 125 | 100 | 9 | 12 | 65 | 32 | 11 | 79 | 25 | 41 |
| 100 | 7.20 | 9.60 | 52.00 | 25.60 | 8.80 | 63.20 | 20.00 | 32.80 | ||
Primers and conditions for detecting vanA and vanB genes by PCR
| Primers (5′—>3′) | Amplification | Reference (length of the amplicon) |
|---|---|---|
| 96°C2 min, 1 cycle | ||
| 94°C30 s | ||
| vanA | 50°C30 s, 35 cycles | Woodford et al. (32) |
| F: ATGGCAAGTCAGGTGAAGATGG | 72°C1 min | (399 bp) |
| R: TCCACCTCGCCAACAACTAACG | 72°C10 min, 1 cycle | |
| 94°C3 min, 1 cycle | ||
| vanB | 94°C30 s | |
| F: CAAAGCTCCGCAGCTTGCATG | 58°C2 min, 40 cycles | Dahl et al. (10) |
| R: TGCATCCAAGCACCCGATATAC | 72°C2 min | (484 bp) |
| 72°C6 min, 1 cycle |