Skip to main content
Have a personal or library account? Click to login
Antimicrobial resistance of Enterococcus species isolated from wild mammals in Aragón, Spain Cover

Antimicrobial resistance of Enterococcus species isolated from wild mammals in Aragón, Spain

Open Access
|Apr 2022

Figures & Tables

Table 1

Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated

Mammal orderSpeciesScientific nameOriginMain dietScavenging habit**Individuals (n)Isolates (n)
ArtiodactylaIberian ibexCapra pyrenaicaCWFR-LAHerbivorousNo10
MouflonOvis orientalisHuntingHerbivorousNo44
Red deerCervus elaphusHuntingHerbivorousNo910
Roe deerCapreolus capreolusCWFR-LAHerbivorousNo12
Wild boarSus scrofaHuntingOmnivorousNo1716
Total3232
CarnivoraAmerican minkNeovison visonCWFR-LACarnivorousYes611
BadgerMeles melesCWFR-LAOmnivorousYes36
Beech martenMartes foinaCWFR-LACarnivorousYes24
Common genetGenetta genettaCWFR-LACarnivorousYes12
Common otter*Lutra lutraCWFR-LAPiscivorousYes38
Red foxVulpes vulpesCWFR-LACarnivorousYes33
WeaselMustela nivalisCWFR-LACarnivorousYes10
Total1934
ChiropteraEuropean bat free-tailedTadarida teniotisCWFR-LAInsectivorousNo12
Total12
ErinaceomorphaHedgehogErinaceus europaeusCWFR-LAInsectivorousNo1124
Total1124
LagomorphaWild rabbitOryctolagus cuniculusHuntingHerbivorousNo3833
Granada hareLepus granatensisHuntingHerbivorousNo21
Total4034
TOTAL16103126

[i] * – one enterococcus isolated from a common otter was missing after identification; **– occasional carrion eaters were excluded; CWFR – Centre of Wild Fauna Recovery of La Alfranca (Aragón, Spain)

Table 2

Primers and conditions for detecting vanA and vanB genes by PCR

Primers (5′—>3′)AmplificationReference (length of the amplicon)
96°C2 min, 1 cycle
94°C30 s
vanA50°C30 s, 35 cyclesWoodford et al. (32)
F: ATGGCAAGTCAGGTGAAGATGG72°C1 min(399 bp)
R: TCCACCTCGCCAACAACTAACG72°C10 min, 1 cycle
94°C3 min, 1 cycle
vanB94°C30 s
F: CAAAGCTCCGCAGCTTGCATG58°C2 min, 40 cyclesDahl et al. (10)
R: TGCATCCAAGCACCCGATATAC72°C2 min(484 bp)
72°C6 min, 1 cycle
Table 3

Frequency of Enterococcus spp. isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin

Enterococcus spp.Isolates (n)Isolates (%)Resistance to QD n (%)
Enterococcus faecalis4737.6038 (80.85)
Enterococcus casseliflavus2620.638 (30.77)
Enterococcus faecium2217.4612 (54.55)
Enterococcus hirae13 (−1)9.609 (75.00)
Enterococcus gallinarum97.145 (55.56)
Enterococcus mundtii86.356 (75.00)
Enterococcus avium10.791 (100.00)
TOTAL125*10079 (63.20)
Species OrderIsolates (n)Isolates (%)Resistance to QD n (%)P value for associations
Artiodactyla3225.6011 (34.38)Lag. vs Art. F 0.0000
Carnivora3326.4020 (60.61)Carn. vs Art. 0.0195
Chiroptera21.62 (100.00)
Erinaceomorpha2419.216 (66.67)Erin. vs Art. 0.0100
Lagomorpha3427.230 (88.24)
AgeP value for associations
Adult7056.0037 (52.86)Young vs Adult 0.0052
Young5040.0038 (76.00)
Infant54.004 (80.0)Not applicable
TOTAL125*10079 (63.20)

[i] Art. – Artiodactyla; Car. – Carnivora; Erin. – Erinaceomorpha; Lag. – Lagomorpha; QD – quinupristin-dalfopristin; * – A total of 126 isolates were retrieved. However, one of the enterococci identified as E. hirae was lost and could not be analysed for antibiotic resistance. The isolate percentages are based on the total of 125

Table 4

Results of the statistical analysis of E. faecalis and E. faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals

FactorVariable (n)E. faecalis n (%)E. faecium n (%)P value*
Source of samplingCWFR-LA (36)19 (52.78)17 (47.22)
Hunting (33)28 (84.85)5 (15.15)0.0025
AgeAdult (32)15 (46.88)17 (53.13)0.0009
Young (32)27 (84.38)5 (15.63)
Infant (5)5 (100.00)0Not applicable
Sex**Female (29)25 (86.21)4 (13.79)F 0.0078
Male (39)22 (56.4117 (43.59)
Main dietCarnivorous (15)8 (53.33)7 (46.67)0.0152
Herbivorous (33)28 (84.85)5 (15.15)
Scavenging habitNo (48)36 (75.00)12 (25.00)
Yes (21)11 (52.38)10 (47.62)0.0383

[i] CWFR – Centre of Wild Fauna Recovery of La Alfranca (Spain); F – Fisher’s exact test; * – χ2 or Fisher’s test where appropriate; statistical significance at P < 0.05; ** – one animal did not have its sex determined

Table 5

Frequency of Enterococcus spp. isolates resistant to the studied antibiotics by mammal species

AMPCLCIPERIGENQDSTE
American mink118.803942638
Badger64.801321434
Beech marten43.202232123
Common genet21.60222
Common otter75.60254533
European free-tailed bat21.60112
Granada hare10.801
Hedgehog2419.20296216410
Mouflon43.20111
Red deer108.0014423
Roe deer21.601121222
Red fox32.401211212
Wild boar1612.80317
Wild rabbit3326.401222652964
TOTAL          N
%
125100912653211792541
1007.209.6052.0025.608.8063.2020.0032.80

[i] AMP – ampicillin; CL – chloramphenicol; CIP – ciprofloxacin; ERI – erythromycin; GEN – gentamicin; QD – quinupristin-dalfopristin; S – streptomycin; TE – tetracycline. No enterococci resistant to any of the studied antibiotics were recovered from the Iberian ibex or weasel

Table 6

Antibiotic resistance of Enterococcus spp. isolates in relation to sample source and order

FactorAntibioticFactor category (n)Antibiotic resistance n (%)P value*
Source of samplesERICWFR-LA (61)21 (34.43)0.0149
Hunting (64)11 (17.19)
SCWFR-LA (61)18 (29.51)0.0024
Hunting (64)6 (9.38)
TECWFR-LA (61)34 (55.74)0.0000
Hunting (64)7 (10.94)
OrderCIPArtiodactyla (32)9 (28.13)0.0018
Carnivora (33)24 (72.73)
Erinaceomorpha (24)9 (37.50)
Lagomorpha (34)22 (64.71)
Chiroptera (2)1 (50.00)
TEArtiodactyla (32)5 (15.63)0.0000
Carnivora (33)22 (66.67)
Erinaceomorpha (24)10 (41.67)
Lagomorpha (34)4 (11.76)
Chiroptera (2)0Not applicable

[i] CIP – ciprofloxacin; ERI – erythromycin; S – streptomycin; TE – tetracycline; * – χ2, statistical significance at P < 0.05. Only statistically significant associations are included

Table 7

Antibiotic resistance of Enterococcus spp. isolates in relation to sex, main diet and scavenging habit

FactorAntibioticFactor category (n)Antibiotic resistance n (%)P value*
CIPFemale (48)31 (64.58)0.0096
SexMale (75)32 (42.67)
Female (48)8 (16.67)
GENMale (75)3 (4.00)F 0.0200
AMPCarnivorous (20)5 (25.00)F 0.0376
Herbivorous (50)3 (6.00)
Carnivorous (20)16 (80.00)Carn. vs Omn: F 0.0008
Herbivorous (50)28 (56.00)
CIPInsectivorous (26)10 (38.46)
Main dietOmnivorous (22)6 (27.27)
Piscivorous (7)5 (71.43)
Carnivorous (20)15 (75.00)Carn. vs Herb. 0.0000
TEHerbivorous (50)9 (18.00)Carn. vs Ins. 0.0084
Insectivorous (26)10 (38.46)Carn. vs Omn. F 0.0003
Omnivorous (22)4 (18.18)Ins. vs Herb. 0.0313
AMPNo (92)3 (3.26)F 0.0104
Yes (33)6 (18.18)
CLNo (92)6 (6.52)0.0368
Yes (33)6 (18.18)
No (92)41 (44.57)
Scavenging habitCIPYes (33)24 (72.73)0.0029
No (92)19 (20.65)
ERIYes (33)13 (39.39)0.0215
No (92)12 (13.04)
SYes (33)12 (36.36)0.0032
TENo (92)19 (20.65)0.0000
Yes (33)22 (66.67)

[i] AMP – ampicillin; CIP – ciprofloxacin; CL – chloramphenicol; ERI – erythromycin; GEN – gentamicin; S – streptomycin; TE – tetracycline; F – Fisher’s exact test; Carn. – carnivorous; Herb. – herbivorous; Omn. – omnivorous; * – χ2 or Fisher’s test where appropriate; statistical significance at P < 0.05. Only statistically significant associations are included

DOI: https://doi.org/10.2478/jvetres-2022-0020 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 151 - 159
Submitted on: Dec 15, 2021
Accepted on: Apr 4, 2022
Published on: Apr 22, 2022
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2022 Leticia Alcalá García, Carmen Torres, Antonio Rezusta López, Carmelo Ortega Rodríguez, Carmen Simón Valencia, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.