Table 1
Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated
| Mammal order | Species | Scientific name | Origin | Main diet | Scavenging habit** | Individuals (n) | Isolates (n) |
|---|---|---|---|---|---|---|---|
| Artiodactyla | Iberian ibex | Capra pyrenaica | CWFR-LA | Herbivorous | No | 1 | 0 |
| Mouflon | Ovis orientalis | Hunting | Herbivorous | No | 4 | 4 | |
| Red deer | Cervus elaphus | Hunting | Herbivorous | No | 9 | 10 | |
| Roe deer | Capreolus capreolus | CWFR-LA | Herbivorous | No | 1 | 2 | |
| Wild boar | Sus scrofa | Hunting | Omnivorous | No | 17 | 16 | |
| Total | 32 | 32 | |||||
| Carnivora | American mink | Neovison vison | CWFR-LA | Carnivorous | Yes | 6 | 11 |
| Badger | Meles meles | CWFR-LA | Omnivorous | Yes | 3 | 6 | |
| Beech marten | Martes foina | CWFR-LA | Carnivorous | Yes | 2 | 4 | |
| Common genet | Genetta genetta | CWFR-LA | Carnivorous | Yes | 1 | 2 | |
| Common otter* | Lutra lutra | CWFR-LA | Piscivorous | Yes | 3 | 8 | |
| Red fox | Vulpes vulpes | CWFR-LA | Carnivorous | Yes | 3 | 3 | |
| Weasel | Mustela nivalis | CWFR-LA | Carnivorous | Yes | 1 | 0 | |
| Total | 19 | 34 | |||||
| Chiroptera | European bat free-tailed | Tadarida teniotis | CWFR-LA | Insectivorous | No | 1 | 2 |
| Total | 1 | 2 | |||||
| Erinaceomorpha | Hedgehog | Erinaceus europaeus | CWFR-LA | Insectivorous | No | 11 | 24 |
| Total | 11 | 24 | |||||
| Lagomorpha | Wild rabbit | Oryctolagus cuniculus | Hunting | Herbivorous | No | 38 | 33 |
| Granada hare | Lepus granatensis | Hunting | Herbivorous | No | 2 | 1 | |
| Total | 40 | 34 | |||||
| TOTAL | 16 | 103 | 126 |
Table 2
Primers and conditions for detecting vanA and vanB genes by PCR
| Primers (5′—>3′) | Amplification | Reference (length of the amplicon) |
|---|---|---|
| 96°C2 min, 1 cycle | ||
| 94°C30 s | ||
| vanA | 50°C30 s, 35 cycles | Woodford et al. (32) |
| F: ATGGCAAGTCAGGTGAAGATGG | 72°C1 min | (399 bp) |
| R: TCCACCTCGCCAACAACTAACG | 72°C10 min, 1 cycle | |
| 94°C3 min, 1 cycle | ||
| vanB | 94°C30 s | |
| F: CAAAGCTCCGCAGCTTGCATG | 58°C2 min, 40 cycles | Dahl et al. (10) |
| R: TGCATCCAAGCACCCGATATAC | 72°C2 min | (484 bp) |
| 72°C6 min, 1 cycle |
Table 3
Frequency of Enterococcus spp. isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin
| Enterococcus spp. | Isolates (n) | Isolates (%) | Resistance to QD n (%) | |
|---|---|---|---|---|
| Enterococcus faecalis | 47 | 37.60 | 38 (80.85) | |
| Enterococcus casseliflavus | 26 | 20.63 | 8 (30.77) | |
| Enterococcus faecium | 22 | 17.46 | 12 (54.55) | |
| Enterococcus hirae | 13 (−1) | 9.60 | 9 (75.00) | |
| Enterococcus gallinarum | 9 | 7.14 | 5 (55.56) | |
| Enterococcus mundtii | 8 | 6.35 | 6 (75.00) | |
| Enterococcus avium | 1 | 0.79 | 1 (100.00) | |
| TOTAL | 125* | 100 | 79 (63.20) | |
| Species Order | Isolates (n) | Isolates (%) | Resistance to QD n (%) | P value for associations |
| Artiodactyla | 32 | 25.60 | 11 (34.38) | Lag. vs Art. F 0.0000 |
| Carnivora | 33 | 26.40 | 20 (60.61) | Carn. vs Art. 0.0195 |
| Chiroptera | 2 | 1.6 | 2 (100.00) | |
| Erinaceomorpha | 24 | 19.2 | 16 (66.67) | Erin. vs Art. 0.0100 |
| Lagomorpha | 34 | 27.2 | 30 (88.24) | |
| Age | P value for associations | |||
| Adult | 70 | 56.00 | 37 (52.86) | Young vs Adult 0.0052 |
| Young | 50 | 40.00 | 38 (76.00) | |
| Infant | 5 | 4.00 | 4 (80.0) | Not applicable |
| TOTAL | 125* | 100 | 79 (63.20) |
[i] Art. – Artiodactyla; Car. – Carnivora; Erin. – Erinaceomorpha; Lag. – Lagomorpha; QD – quinupristin-dalfopristin; * – A total of 126 isolates were retrieved. However, one of the enterococci identified as E. hirae was lost and could not be analysed for antibiotic resistance. The isolate percentages are based on the total of 125
Table 4
Results of the statistical analysis of E. faecalis and E. faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals
| Factor | Variable (n) | E. faecalis n (%) | E. faecium n (%) | P value* |
|---|---|---|---|---|
| Source of sampling | CWFR-LA (36) | 19 (52.78) | 17 (47.22) | |
| Hunting (33) | 28 (84.85) | 5 (15.15) | 0.0025 | |
| Age | Adult (32) | 15 (46.88) | 17 (53.13) | 0.0009 |
| Young (32) | 27 (84.38) | 5 (15.63) | ||
| Infant (5) | 5 (100.00) | 0 | Not applicable | |
| Sex** | Female (29) | 25 (86.21) | 4 (13.79) | F 0.0078 |
| Male (39) | 22 (56.41 | 17 (43.59) | ||
| Main diet | Carnivorous (15) | 8 (53.33) | 7 (46.67) | 0.0152 |
| Herbivorous (33) | 28 (84.85) | 5 (15.15) | ||
| Scavenging habit | No (48) | 36 (75.00) | 12 (25.00) | |
| Yes (21) | 11 (52.38) | 10 (47.62) | 0.0383 |
Table 5
Frequency of Enterococcus spp. isolates resistant to the studied antibiotics by mammal species
| AMP | CL | CIP | ERI | GEN | QD | S | TE | |||
|---|---|---|---|---|---|---|---|---|---|---|
| American mink | 11 | 8.80 | 3 | 9 | 4 | 2 | 6 | 3 | 8 | |
| Badger | 6 | 4.80 | 1 | 3 | 2 | 1 | 4 | 3 | 4 | |
| Beech marten | 4 | 3.20 | 2 | 2 | 3 | 2 | 1 | 2 | 3 | |
| Common genet | 2 | 1.60 | 2 | 2 | 2 | |||||
| Common otter | 7 | 5.60 | 2 | 5 | 4 | 5 | 3 | 3 | ||
| European free-tailed bat | 2 | 1.60 | 1 | 1 | 2 | |||||
| Granada hare | 1 | 0.80 | 1 | |||||||
| Hedgehog | 24 | 19.20 | 2 | 9 | 6 | 2 | 16 | 4 | 10 | |
| Mouflon | 4 | 3.20 | 1 | 1 | 1 | |||||
| Red deer | 10 | 8.00 | 1 | 4 | 4 | 2 | 3 | |||
| Roe deer | 2 | 1.60 | 1 | 1 | 2 | 1 | 2 | 2 | 2 | |
| Red fox | 3 | 2.40 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | |
| Wild boar | 16 | 12.80 | 3 | 1 | 7 | |||||
| Wild rabbit | 33 | 26.40 | 1 | 2 | 22 | 6 | 5 | 29 | 6 | 4 |
| TOTAL N % | 125 | 100 | 9 | 12 | 65 | 32 | 11 | 79 | 25 | 41 |
| 100 | 7.20 | 9.60 | 52.00 | 25.60 | 8.80 | 63.20 | 20.00 | 32.80 |
Table 6
Antibiotic resistance of Enterococcus spp. isolates in relation to sample source and order
| Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
|---|---|---|---|---|
| Source of samples | ERI | CWFR-LA (61) | 21 (34.43) | 0.0149 |
| Hunting (64) | 11 (17.19) | |||
| S | CWFR-LA (61) | 18 (29.51) | 0.0024 | |
| Hunting (64) | 6 (9.38) | |||
| TE | CWFR-LA (61) | 34 (55.74) | 0.0000 | |
| Hunting (64) | 7 (10.94) | |||
| Order | CIP | Artiodactyla (32) | 9 (28.13) | 0.0018 |
| Carnivora (33) | 24 (72.73) | |||
| Erinaceomorpha (24) | 9 (37.50) | |||
| Lagomorpha (34) | 22 (64.71) | |||
| Chiroptera (2) | 1 (50.00) | |||
| TE | Artiodactyla (32) | 5 (15.63) | 0.0000 | |
| Carnivora (33) | 22 (66.67) | |||
| Erinaceomorpha (24) | 10 (41.67) | |||
| Lagomorpha (34) | 4 (11.76) | |||
| Chiroptera (2) | 0 | Not applicable |
Table 7
Antibiotic resistance of Enterococcus spp. isolates in relation to sex, main diet and scavenging habit
| Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
|---|---|---|---|---|
| CIP | Female (48) | 31 (64.58) | 0.0096 | |
| Sex | Male (75) | 32 (42.67) | ||
| Female (48) | 8 (16.67) | |||
| GEN | Male (75) | 3 (4.00) | F 0.0200 | |
| AMP | Carnivorous (20) | 5 (25.00) | F 0.0376 | |
| Herbivorous (50) | 3 (6.00) | |||
| Carnivorous (20) | 16 (80.00) | Carn. vs Omn: F 0.0008 | ||
| Herbivorous (50) | 28 (56.00) | |||
| CIP | Insectivorous (26) | 10 (38.46) | ||
| Main diet | Omnivorous (22) | 6 (27.27) | ||
| Piscivorous (7) | 5 (71.43) | |||
| Carnivorous (20) | 15 (75.00) | Carn. vs Herb. 0.0000 | ||
| TE | Herbivorous (50) | 9 (18.00) | Carn. vs Ins. 0.0084 | |
| Insectivorous (26) | 10 (38.46) | Carn. vs Omn. F 0.0003 | ||
| Omnivorous (22) | 4 (18.18) | Ins. vs Herb. 0.0313 | ||
| AMP | No (92) | 3 (3.26) | F 0.0104 | |
| Yes (33) | 6 (18.18) | |||
| CL | No (92) | 6 (6.52) | 0.0368 | |
| Yes (33) | 6 (18.18) | |||
| No (92) | 41 (44.57) | |||
| Scavenging habit | CIP | Yes (33) | 24 (72.73) | 0.0029 |
| No (92) | 19 (20.65) | |||
| ERI | Yes (33) | 13 (39.39) | 0.0215 | |
| No (92) | 12 (13.04) | |||
| S | Yes (33) | 12 (36.36) | 0.0032 | |
| TE | No (92) | 19 (20.65) | 0.0000 | |
| Yes (33) | 22 (66.67) |
[i] AMP – ampicillin; CIP – ciprofloxacin; CL – chloramphenicol; ERI – erythromycin; GEN – gentamicin; S – streptomycin; TE – tetracycline; F – Fisher’s exact test; Carn. – carnivorous; Herb. – herbivorous; Omn. – omnivorous; * – χ2 or Fisher’s test where appropriate; statistical significance at P < 0.05. Only statistically significant associations are included