Have a personal or library account? Click to login
Antimicrobial resistance of Enterococcus species isolated from wild mammals in Aragón, Spain Cover

Antimicrobial resistance of Enterococcus species isolated from wild mammals in Aragón, Spain

Open Access
|Apr 2022

Figures & Tables

Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated

Mammal orderSpeciesScientific nameOriginMain dietScavenging habit**Individuals (n)Isolates (n)
ArtiodactylaIberian ibexCapra pyrenaicaCWFR-LAHerbivorousNo10
MouflonOvis orientalisHuntingHerbivorousNo44
Red deerCervus elaphusHuntingHerbivorousNo910
Roe deerCapreolus capreolusCWFR-LAHerbivorousNo12
Wild boarSus scrofaHuntingOmnivorousNo1716
Total 3232

CarnivoraAmerican minkNeovison visonCWFR-LACarnivorousYes611
BadgerMeles melesCWFR-LAOmnivorousYes36
Beech martenMartes foinaCWFR-LACarnivorousYes24
Common genetGenetta genettaCWFR-LACarnivorousYes12
Common otter*Lutra lutraCWFR-LAPiscivorousYes38
Red foxVulpes vulpesCWFR-LACarnivorousYes33
WeaselMustela nivalisCWFR-LACarnivorousYes10
Total 1934

ChiropteraEuropean bat free-tailedTadarida teniotisCWFR-LAInsectivorousNo12
Total 12

ErinaceomorphaHedgehogErinaceus europaeusCWFR-LAInsectivorousNo1124
Total 1124

LagomorphaWild rabbitOryctolagus cuniculusHuntingHerbivorousNo3833
Granada hareLepus granatensisHuntingHerbivorousNo21
Total 4034

TOTAL16 103126

Antibiotic resistance of Enterococcus spp_ isolates in relation to sample source and order

FactorAntibioticFactor category (n)Antibiotic resistance n (%)P value*
Source of samplesERICWFR-LA (61)21 (34.43)0.0149
Hunting (64)11 (17.19)

SCWFR-LA (61)18 (29.51)0.0024
Hunting (64)6 (9.38)

TECWFR-LA (61)34 (55.74)0.0000
Hunting (64)7 (10.94)

OrderCIPArtiodactyla (32)9 (28.13)0.0018
Carnivora (33)24 (72.73)
Erinaceomorpha (24)9 (37.50)
Lagomorpha (34)22 (64.71)
Chiroptera (2)1 (50.00)

TEArtiodactyla (32)5 (15.63)0.0000
Carnivora (33)22 (66.67)
Erinaceomorpha (24)10 (41.67)
Lagomorpha (34)4 (11.76)
Chiroptera (2)0Not applicable

Frequency of Enterococcus spp_ isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin

Enterococcus spp.Isolates (n)Isolates (%)Resistance to QD n (%)
Enterococcus faecalis4737.6038 (80.85)
Enterococcus casseliflavus2620.638 (30.77)
Enterococcus faecium2217.4612 (54.55)
Enterococcus hirae13 (−1)9.609 (75.00)
Enterococcus gallinarum97.145 (55.56)
Enterococcus mundtii86.356 (75.00)
Enterococcus avium10.791 (100.00)

TOTAL125*10079 (63.20)

Species OrderIsolates (n)Isolates (%)Resistance to QD n (%)P value for associations

Artiodactyla3225.6011 (34.38)Lag. vs Art. F 0.0000
Carnivora3326.4020 (60.61)Carn. vs Art. 0.0195
Chiroptera21.62 (100.00)
Erinaceomorpha2419.216 (66.67)Erin. vs Art. 0.0100
Lagomorpha3427.230 (88.24)

Age P value for associations

Adult7056.0037 (52.86)Young vs Adult 0.0052
Young5040.0038 (76.00)
Infant54.004 (80.0)Not applicable

TOTAL125*10079 (63.20)

Results of the statistical analysis of E_ faecalis and E_ faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals

FactorVariable (n)E. faecalis n (%)E. faecium n (%)P value*
Source of samplingCWFR-LA (36)19 (52.78)17 (47.22)
Hunting (33)28 (84.85)5 (15.15)0.0025

AgeAdult (32)15 (46.88)17 (53.13)0.0009
Young (32)27 (84.38)5 (15.63)
Infant (5)5 (100.00)0Not applicable

Sex**Female (29)25 (86.21)4 (13.79)F 0.0078
Male (39)22 (56.4117 (43.59)

Main dietCarnivorous (15)8 (53.33)7 (46.67)0.0152
Herbivorous (33)28 (84.85)5 (15.15)

Scavenging habitNo (48)36 (75.00)12 (25.00)
Yes (21)11 (52.38)10 (47.62)0.0383

Antibiotic resistance of Enterococcus spp_ isolates in relation to sex, main diet and scavenging habit

FactorAntibioticFactor category (n)Antibiotic resistance n (%)P value*
CIPFemale (48)31 (64.58)0.0096
Sex Male (75)32 (42.67)

Female (48)8 (16.67)
GENMale (75)3 (4.00)F 0.0200

AMPCarnivorous (20)5 (25.00)F 0.0376
Herbivorous (50)3 (6.00)

Carnivorous (20)16 (80.00)Carn. vs Omn: F 0.0008
Herbivorous (50)28 (56.00)
CIPInsectivorous (26)10 (38.46)
Main diet Omnivorous (22)6 (27.27)
Piscivorous (7)5 (71.43)

Carnivorous (20)15 (75.00)Carn. vs Herb. 0.0000
TEHerbivorous (50)9 (18.00)Carn. vs Ins. 0.0084
Insectivorous (26)10 (38.46)Carn. vs Omn. F 0.0003
Omnivorous (22)4 (18.18)Ins. vs Herb. 0.0313

AMPNo (92)3 (3.26)F 0.0104
Yes (33)6 (18.18)

CLNo (92)6 (6.52)0.0368
Yes (33)6 (18.18)

No (92)41 (44.57)
Scavenging habitCIPYes (33)24 (72.73)0.0029

No (92)19 (20.65)
ERIYes (33)13 (39.39)0.0215

No (92)12 (13.04)
SYes (33)12 (36.36)0.0032

TENo (92)19 (20.65)0.0000
Yes (33)22 (66.67)

Frequency of Enterococcus spp_ isolates resistant to the studied antibiotics by mammal species

SpeciesEnterococcus spp. isolates (n)Enterococcus spp. (%)Antibiotic tested
AMPCLCIPERIGENQDSTE
American mink118.803 942638
Badger64.801 321434
Beech marten43.202232 123
Common genet21.60 2 2 2
Common otter75.60 254 533
European free-tailed bat21.60 11 2
Granada hare10.80 1
Hedgehog2419.20 296216410
Mouflon43.2011 1
Red deer108.00 144 2 3
Roe deer21.601121 222
Red fox32.40 1211212
Wild boar1612.80 31 7
Wild rabbit3326.401222652964

TOTAL          N%125100912653211792541
1007.209.6052.0025.608.8063.2020.0032.80

Primers and conditions for detecting vanA and vanB genes by PCR

Primers (5′—>3′)AmplificationReference (length of the amplicon)
96°C2 min, 1 cycle
94°C30 s
vanA50°C30 s, 35 cyclesWoodford et al. (32)
F: ATGGCAAGTCAGGTGAAGATGG72°C1 min(399 bp)
R: TCCACCTCGCCAACAACTAACG72°C10 min, 1 cycle
94°C3 min, 1 cycle
vanB94°C30 s
F: CAAAGCTCCGCAGCTTGCATG58°C2 min, 40 cyclesDahl et al. (10)
R: TGCATCCAAGCACCCGATATAC72°C2 min(484 bp)
72°C6 min, 1 cycle
Language: English
Page range: 151 - 159
Submitted on: Dec 15, 2021
|
Accepted on: Apr 4, 2022
|
Published on: Apr 22, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Leticia Alcalá García, Carmen Torres, Antonio Rezusta López, Carmelo Ortega Rodríguez, Carmen Simón Valencia, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.