Skip to main content
Have a personal or library account? Click to login
In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain Cover

In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain

Journal of Veterinary Research
Volume 66 (2022): Issue 1 (March 2022)
By: ,   and    
Open Access
|Mar 2022
Figures & tables

Figures & Tables

Table 1

Primers used in this study

PrimerSequence (5′-3′)PCR product (bp)Target organismReference
MD16S1-FATCTAATGGCTTAACCATTAAAC857Campylobacter spp.(10)
MD16S2-RGGACGGTAACTAGTTTAGTATT589C. jejuni
MDmapA1-FCTATTTTATTTTTGAGTGCTTGTG
MDmapA2-RGCTTTATTTGCCATTTGTTTTATTA
L15fGCTCAGGAYGAACGCYGG750lactic acid bacteria(9)
L687rCACCGCTACACATGRADTTC
lsFGAGCTTGCTCCTCATTGATAA
lsRTTGGATACCGTCACTACCTG434Lactobacillus sakei(17)

[i] F and f – forward; R and r – reverse

Table 2

Optimised PCR conditions used in this study adapted from Subejano & Penuliar (26)

PCR stepMD16S1-F / MD16S2-RMDmapA1-F / MDmapA2-RL15f / L687rlsF / lsRNumber of cycles
Initial denaturation95°C, 2 min95°C, 2 min95°C, 2 min95°C, 2 min1
Denaturation95°C, 1 min95°C, 1 min95°C, 1 min95°C, 1 min
Annealing49°C, 1 min53°C, 1 min60°C, 1 min60°C, 1 min35
Extension72°C, 1 min72°C, 1 min72°C, 1 min72°C, 1 min
Final extension72°C, 5 min72°C, 5 min72°C, 5 min72°C, 5 min1

[i] F and f – forward; R and r – reverse

Fig. 1

Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 2

Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 3

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 4

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 5

Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS

Fig. 6

Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS

Table 3a

Campylobacter spp. detection results from pooled faecal samples

pre135791113151719212325272931
1-----------------
2-------+---------
3---+--++---+++-++
4-----------------

[i] Group 1 – Untreated; Group 2 – Campylobacter jejuni DC3 only; Group 3 – C. jejuni DC3 and Lactobacillus sakei L14 co-infection; Group 4 – L. sakei L14 only

Table 3b

Lactobacillus sakei L14 PCR detection results from pooled faecal samples

pre135791113151719212325272931
1-----------------
2-----------------
3-+-----+--++-----
4-+--------++++---

[i] Group 1 – Untreated; Group 2 – Campylobacter jejuni DC3 only; Group 3 – C. jejuni DC3 and L. sakei L14 co-infection; Group 4 – L. sakei L14 only

Table 3c

Lactic acid bacteria PCR detection results from pooled faecal samples

pre135791113151719212325272931
1+++++++++++++++++
2+++++++++++++++++
3+++++++++++++++++
4+++++++++++++++++

[i] Group 1 – Untreated; Group 2 – Campylobacter jejuni DC3 only; Group 3 – C. jejuni DC3 and Lactobacillus sakei L14 co-infection; Group 4 – L. sakei L14 only

Table 4

Campylobacter spp. PCR detection results from individual gut samples at 33 days post infection

ABCD
1---n/a
2---n/a
3++++
4----
DOI: https://doi.org/10.2478/jvetres-2022-0015 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Journal RSS Feed
Language: English
Page range: 85 - 94
Submitted on: Sep 12, 2021
Accepted on: Mar 6, 2022
Published on: Mar 25, 2022
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Keywords:
lactic acid bacteria,
Lactobacillus sakei,
Campylobacter jejuni,
chickens,
growth inhibition
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2022 John Roybert P. Catacutan, Ma. Socorro Edden P. Subejano, Gil M. Penuliar, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 66 (2022): Issue 1 (March 2022)
Previous article
Next article