In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain Cover

.blurhash-client-img { display: none !important; }

In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain

Journal of Veterinary Research

Volume 66 (2022): Issue 1 (March 2022)

By: John Roybert P. Catacutan, Ma. Socorro Edden P. Subejano and Gil M. Penuliar

Open Access

|Mar 2022

Figures & Tables

Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS

Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS

Primers used in this study

Primer	Sequence (5′-3′)	PCR product (bp)	Target organism	Reference
MD16S1-F	ATCTAATGGCTTAACCATTAAAC	857	Campylobacter spp.	(10)
MD16S2-R	GGACGGTAACTAGTTTAGTATT	589	C. jejuni

MDmapA1-F	CTATTTTATTTTTGAGTGCTTGTG
MDmapA2-R	GCTTTATTTGCCATTTGTTTTATTA

L15f	GCTCAGGAYGAACGCYGG	750	lactic acid bacteria	(9)
L687r	CACCGCTACACATGRADTTC

lsF	GAGCTTGCTCCTCATTGATAA
lsR	TTGGATACCGTCACTACCTG	434	Lactobacillus sakei	(17)

Campylobacter spp_ detection results from pooled faecal samples

Group	Days post infection
Group	pre	1	3	5	7	9	11	13	15	17	19	21	23	25	27	29	31
1	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
2	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-
3	-	-	-	+	-	-	+	+	-	-	-	+	+	+	-	+	+
4	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-

Lactobacillus sakei L14 PCR detection results from pooled faecal samples

Group	Days post infection
Group	pre	1	3	5	7	9	11	13	15	17	19	21	23	25	27	29	31
1	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
2	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
3	-	+	-	-	-	-	-	+	-	-	+	+	-	-	-	-	-
4	-	+	-	-	-	-	-	-	-	-	+	+	+	+	-	-	-

Lactic acid bacteria PCR detection results from pooled faecal samples

Group	Days post infection
Group	pre	1	3	5	7	9	11	13	15	17	19	21	23	25	27	29	31
1	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
2	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
3	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
4	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+

Campylobacter spp_ PCR detection results from individual gut samples at 33 days post infection

Group	Sample
Group	A	B	C	D
1	-	-	-	n/a
2	-	-	-	n/a
3	+	+	+	+
4	-	-	-	-

Optimised PCR conditions used in this study adapted from Subejano & Penuliar (26)

PCR step	MD16S1-F / MD16S2-R	MDmapA1-F / MDmapA2-R	L15f / L687r	lsF / lsR	Number of cycles
Initial denaturation	95°C, 2 min	95°C, 2 min	95°C, 2 min	95°C, 2 min	1

Denaturation	95°C, 1 min	95°C, 1 min	95°C, 1 min	95°C, 1 min
Annealing	49°C, 1 min	53°C, 1 min	60°C, 1 min	60°C, 1 min	35
Extension	72°C, 1 min	72°C, 1 min	72°C, 1 min	72°C, 1 min

Final extension	72°C, 5 min	72°C, 5 min	72°C, 5 min	72°C, 5 min	1

DOI: https://doi.org/10.2478/jvetres-2022-0015 | Journal eISSN: 2450-8608

Journal RSS Feed

Language: English

Page range: 85 - 94

Submitted on: Sep 12, 2021

Accepted on: Mar 6, 2022

Published on: Mar 25, 2022

Published by: National Veterinary Research Institute in Pulawy

In partnership with: Paradigm Publishing Services

Publication frequency: 4 issues per year

Keywords:

lactic acid bacteria,

growth inhibition

Related subjects:

Molecular biology,

Microbiology and virology,

Life sciences, other,

Veterinary medicine

© 2022 John Roybert P. Catacutan, Ma. Socorro Edden P. Subejano, Gil M. Penuliar, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous article Volume 66 (2022): Issue 1 (March 2022)Next article