Have a personal or library account? Click to login
In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain Cover

In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain

Open Access
|Mar 2022

Figures & Tables

Fig. 1

Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error
Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 2

Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error
Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 3

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error
Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 4

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error
Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 5

Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS
Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS

Fig. 6

Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS
Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS

Primers used in this study

PrimerSequence (5′-3′)PCR product (bp)Target organismReference
MD16S1-FATCTAATGGCTTAACCATTAAAC857Campylobacter spp.(10)
MD16S2-RGGACGGTAACTAGTTTAGTATT589C. jejuni

MDmapA1-FCTATTTTATTTTTGAGTGCTTGTG
MDmapA2-RGCTTTATTTGCCATTTGTTTTATTA

L15fGCTCAGGAYGAACGCYGG750lactic acid bacteria(9)
L687rCACCGCTACACATGRADTTC

lsFGAGCTTGCTCCTCATTGATAA
lsRTTGGATACCGTCACTACCTG434Lactobacillus sakei(17)

Campylobacter spp_ detection results from pooled faecal samples

GroupDays post infection
pre135791113151719212325272931
1-----------------
2-------+---------
3---+--++---+++-++
4-----------------

Lactobacillus sakei L14 PCR detection results from pooled faecal samples

GroupDays post infection
pre135791113151719212325272931
1-----------------
2-----------------
3-+-----+--++-----
4-+--------++++---

Lactic acid bacteria PCR detection results from pooled faecal samples

GroupDays post infection
pre135791113151719212325272931
1+++++++++++++++++
2+++++++++++++++++
3+++++++++++++++++
4+++++++++++++++++

Campylobacter spp_ PCR detection results from individual gut samples at 33 days post infection

GroupSample
ABCD
1---n/a
2---n/a
3++++
4----

Optimised PCR conditions used in this study adapted from Subejano & Penuliar (26)

PCR stepMD16S1-F / MD16S2-RMDmapA1-F / MDmapA2-RL15f / L687rlsF / lsRNumber of cycles
Initial denaturation95°C, 2 min95°C, 2 min95°C, 2 min95°C, 2 min1

Denaturation95°C, 1 min95°C, 1 min95°C, 1 min95°C, 1 min
Annealing49°C, 1 min53°C, 1 min60°C, 1 min60°C, 1 min35
Extension72°C, 1 min72°C, 1 min72°C, 1 min72°C, 1 min

Final extension72°C, 5 min72°C, 5 min72°C, 5 min72°C, 5 min1
Language: English
Page range: 85 - 94
Submitted on: Sep 12, 2021
|
Accepted on: Mar 6, 2022
|
Published on: Mar 25, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 John Roybert P. Catacutan, Ma. Socorro Edden P. Subejano, Gil M. Penuliar, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.