Have a personal or library account? Click to login
Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4 Cover

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

Open Access
|Mar 2022

Figures & Tables

Fig. 1

Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)
Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)

Fig. 2

Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL
Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL

Repeatability test of qPCR

Positive plasmid concentrationIntra-assayInter-assay
(copies/μL)Ct (mean ± SD)CV %Ct (mean ± SD)CV %
2.20 × 10518.15 ± 0.221.2118.14 ± 0.251.38
2.20 × 10421.48 ± 0.140.6521.49 ± 0.180.84
2.20 × 10324.98 ± 0.160.6424.92 ± 0.281.12
2.20 × 10228.56 ± 0.361.2628.53 ± 0.481.68

Nucleotide sequences of PCV4 primers and PCV4 probe

PrimerNucleotide sequence (5ʹ–3ʹ)Nt position
PCV4-FAATCTCACTGTCCACACCTG1105–1124
PCV4-RCAAAACCCCAGGACCCATC1267–1249
PCV4-probeFAM-ACCCACACCCTCCACTTCCAGC-BHQ1
Language: English
Page range: 29 - 33
Submitted on: Jul 1, 2021
|
Accepted on: Jan 11, 2022
|
Published on: Mar 25, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Wanting Chen, Dike Jiang, Lu Xiao, Pengfei Zhang, Yan Luo, Zexiao Yang, Xueping Yao, Yin Wang, Xulong Wu, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.