Have a personal or library account? Click to login
Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats Cover

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Open Access
|Oct 2021

Figures & Tables

Fig. 1

Changes in interleukin expression in the lungs. Ctrl – Group I (control); 3 h – Group II; 24 h – Group III; 48 h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

Fig. 2

Changes in interleukin expression in the liver. Ctrl – Group I (control); 3h – Group II; 24h – Group III; 48h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

Genes and sequences of primers used in the experiment

Gene nameGenBank number5ʹ→3ʹExon junctionProduct length (bp)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)NM_017008.4ForwardCATGGCCTTCCGTGTTCCTA 74

ReverseACTTGGCAGGTTTCTCCAGG825/826

Nuclear factor of kappa-light-chain- enhancer in B - cells 1 (NF-κB1)NM_001276711.1ForwardGCCAACTGGCAGGTATTTGAC2694/2695117

ReverseTTGCAGCCTCGTGTCTTCTG

Nuclear factor of kappa-light-chain- enhancer in B - cells 2, p49/p100 (NF-κB2)NM_001008349.1ForwardTGGTACAGAGCGGTAAGAGTG2326/2327134

ReverseTCTGTCTCAGCCAGGCTACC

Interleukin 10 (IL-10)NM_012854.2ForwardTGCGACGCTGTCATCGATTT379/380129

ReverseTGGCCTTGTAGACACCTTTGT

Tumour necrosis factor alpha (TNF-α)NM_012675.3ForwardATGGGCTCCCTCTCATCAGT 106

ReverseGCTTGGTGGTTTGCTACGAC433/434

Interleukin 1beta (IL-1β)NM_031512.2ForwardCCTATGTCTTGCCCGTGGAG 82

ReverseAGAGGACGGGCTCTTCTTCAA354/355

Transforming growth factor, beta 1 (TGF-β1)NM_021578.2ForwardCTGCTGACCCCCACTGATAC 94

ReverseAGCCCTGTATTCCGTCTCCT779/780
Language: English
Page range: 513 - 517
Submitted on: Apr 27, 2020
|
Accepted on: Sep 9, 2021
|
Published on: Oct 6, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2021 Małgorzata Chmielewska-Krzesińska, Krzysztof Wąsowicz, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.