Have a personal or library account? Click to login
Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats Cover

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Journal of Veterinary Research
Volume 65 (2021): Issue 4 (December 2021)
By: Małgorzata Chmielewska-Krzesińska and  Krzysztof Wąsowicz  
Open Access
|Oct 2021

Figures & Tables

Fig. 1

Changes in interleukin expression in the lungs. Ctrl – Group I (control); 3 h – Group II; 24 h – Group III; 48 h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant
Changes in interleukin expression in the lungs. Ctrl – Group I (control); 3 h – Group II; 24 h – Group III; 48 h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

Fig. 2

Changes in interleukin expression in the liver. Ctrl – Group I (control); 3h – Group II; 24h – Group III; 48h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant
Changes in interleukin expression in the liver. Ctrl – Group I (control); 3h – Group II; 24h – Group III; 48h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

Genes and sequences of primers used in the experiment

Gene nameGenBank number5ʹ→3ʹExon junctionProduct length (bp)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)NM_017008.4ForwardCATGGCCTTCCGTGTTCCTA 74
ReverseACTTGGCAGGTTTCTCCAGG825/826
Nuclear factor of kappa-light-chain- enhancer in B - cells 1 (NF-κB1)NM_001276711.1ForwardGCCAACTGGCAGGTATTTGAC2694/2695117
ReverseTTGCAGCCTCGTGTCTTCTG
Nuclear factor of kappa-light-chain- enhancer in B - cells 2, p49/p100 (NF-κB2)NM_001008349.1ForwardTGGTACAGAGCGGTAAGAGTG2326/2327134
ReverseTCTGTCTCAGCCAGGCTACC
Interleukin 10 (IL-10)NM_012854.2ForwardTGCGACGCTGTCATCGATTT379/380129
ReverseTGGCCTTGTAGACACCTTTGT
Tumour necrosis factor alpha (TNF-α)NM_012675.3ForwardATGGGCTCCCTCTCATCAGT 106
ReverseGCTTGGTGGTTTGCTACGAC433/434
Interleukin 1beta (IL-1β)NM_031512.2ForwardCCTATGTCTTGCCCGTGGAG 82
ReverseAGAGGACGGGCTCTTCTTCAA354/355
Transforming growth factor, beta 1 (TGF-β1)NM_021578.2ForwardCTGCTGACCCCCACTGATAC 94
ReverseAGCCCTGTATTCCGTCTCCT779/780
DOI: https://doi.org/10.2478/jvetres-2021-0051 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 513 - 517
Submitted on: Apr 27, 2020
Accepted on: Sep 9, 2021
Published on: Oct 6, 2021
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
ozone,
free radicals,
inflammatory response,
respiratory tract inflammation, rat
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2021 Małgorzata Chmielewska-Krzesińska, Krzysztof Wąsowicz, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous articleVolume 65 (2021): Issue 4 (December 2021)Next article