Skip to main content
Have a personal or library account? Click to login
Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats Cover

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Open Access
|Oct 2021

Figures & Tables

Table 1

Genes and sequences of primers used in the experiment

Gene nameGenBank number5ʹ→3ʹExon junctionProduct length (bp)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)NM_017008.4ForwardCATGGCCTTCCGTGTTCCTA74
ReverseACTTGGCAGGTTTCTCCAGG825/826
Nuclear factor of kappa-light-chain- enhancer in B - cells 1 (NF-κB1)NM_001276711.1ForwardGCCAACTGGCAGGTATTTGAC2694/2695117
ReverseTTGCAGCCTCGTGTCTTCTG
Nuclear factor of kappa-light-chain- enhancer in B - cells 2, p49/p100 (NF-κB2)NM_001008349.1ForwardTGGTACAGAGCGGTAAGAGTG2326/2327134
ReverseTCTGTCTCAGCCAGGCTACC
Interleukin 10 (IL-10)NM_012854.2ForwardTGCGACGCTGTCATCGATTT379/380129
ReverseTGGCCTTGTAGACACCTTTGT
Tumour necrosis factor alpha (TNF-α)NM_012675.3ForwardATGGGCTCCCTCTCATCAGT106
ReverseGCTTGGTGGTTTGCTACGAC433/434
Interleukin 1beta (IL-1β)NM_031512.2ForwardCCTATGTCTTGCCCGTGGAG82
ReverseAGAGGACGGGCTCTTCTTCAA354/355
Transforming growth factor, beta 1 (TGF-β1)NM_021578.2ForwardCTGCTGACCCCCACTGATAC94
ReverseAGCCCTGTATTCCGTCTCCT779/780
Fig. 1

Changes in interleukin expression in the lungs. Ctrl – Group I (control); 3 h – Group II; 24 h – Group III; 48 h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

Fig. 2

Changes in interleukin expression in the liver. Ctrl – Group I (control); 3h – Group II; 24h – Group III; 48h – Group IV. Significance levels are indicated with asterisks: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. Ns – not statistically significant

DOI: https://doi.org/10.2478/jvetres-2021-0051 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 513 - 517
Submitted on: Apr 27, 2020
Accepted on: Sep 9, 2021
Published on: Oct 6, 2021
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2021 Małgorzata Chmielewska-Krzesińska, Krzysztof Wąsowicz, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.