Have a personal or library account? Click to login
Investigation of the prevalence of Mycoplasma ovipneumoniae in Southern Xinjiang, China Cover

Investigation of the prevalence of Mycoplasma ovipneumoniae in Southern Xinjiang, China

Open Access
|Apr 2021

Figures & Tables

Fig. 1

Pathological changes in the lungs of sheep with suspected M. ovipneumoniae infection. A - caseous transformation; B - lung surface consolidation
Pathological changes in the lungs of sheep with suspected M. ovipneumoniae infection. A - caseous transformation; B - lung surface consolidation

Fig. 2

Morphological identification of M. ovipneumoniae. Single colony of M. ovipneumoniae (C, 100×); multi-colony of M. ovipneumoniae (D, 40×)
Morphological identification of M. ovipneumoniae. Single colony of M. ovipneumoniae (C, 100×); multi-colony of M. ovipneumoniae (D, 40×)

Fig. 3

Detection of M. ovipneumoniae and Mycoplasma genus in samples from sheep by PCR. M - DNA marker DL-2000 (2000, 1000, 750, 500, 250, 100 bp); A - 1–20 M. ovipneumoniae positive samples; B - 1–20 Mycoplasma genus positive samples
Detection of M. ovipneumoniae and Mycoplasma genus in samples from sheep by PCR. M - DNA marker DL-2000 (2000, 1000, 750, 500, 250, 100 bp); A - 1–20 M. ovipneumoniae positive samples; B - 1–20 Mycoplasma genus positive samples

Fig. 4

Phylogenetic tree of M. ovipneumoniae based on partial sequences of the M. ovipneumoniae 16S rRNA gene amplified with specific primers. The Mycoplasma 16S rRNA gene sequences were aligned using MEGA 6.0 software; 1000 bootstrap replicates were used to determine the nucleotide sequence distance. A consensus phylogenetic tree was created using the neighbour-joining method. The black boxes signify the M. ovipneumoniae strains XJ-AL-Mo-1, XJ-KC-Mo-1, XJ-MGT-Mo-99 and XJ-yjs-Mo-1 identified in this study. The white boxes signify M. ovipneumoniae strains isolated in northern Xinjiang (Chen et al., 2015). MoGH3-3, GZ-WN, FJ-SM, FJ-01MH are strains from inland China, and the black circle signifies the M. ovipneumoniae international standard strain Y-98
Phylogenetic tree of M. ovipneumoniae based on partial sequences of the M. ovipneumoniae 16S rRNA gene amplified with specific primers. The Mycoplasma 16S rRNA gene sequences were aligned using MEGA 6.0 software; 1000 bootstrap replicates were used to determine the nucleotide sequence distance. A consensus phylogenetic tree was created using the neighbour-joining method. The black boxes signify the M. ovipneumoniae strains XJ-AL-Mo-1, XJ-KC-Mo-1, XJ-MGT-Mo-99 and XJ-yjs-Mo-1 identified in this study. The white boxes signify M. ovipneumoniae strains isolated in northern Xinjiang (Chen et al., 2015). MoGH3-3, GZ-WN, FJ-SM, FJ-01MH are strains from inland China, and the black circle signifies the M. ovipneumoniae international standard strain Y-98

Primers used in this study

SpeciesPrimer namePrimer sequenceAnnealing temperatureAmplicon size (bp)Reference
Mycoplasma genusMGSO RNA5TGCACCATCTGTCACTCTGTTAACCTC AGAGTTTGATCCTGGGCTCAGGA58°C1021(21)
M. ovipneumoniaePP1 2GACTTCATCCTGCACTCTGT TGAACGGAATATGTTAGCTT55°C361(17)

M_ ovipneumoniae PCR detection results in nasal swabs

RegionExaminedPositivePrevalence (%)
Hotan2007638.00
Kashgar24212852.89
Aksu2327331.47
Bazhou1505939.33
Total82433640.78

M_ ovipneumoniae positive rates in nasal swabs by animal age

Age (months) Examined Positive Prevalence (%)
KazakDuolangTotalKazakDuolangTotalKazakDuolangTotal
< 3106130236596712655.6751.5453.39
3-12788516338377550.6749.3346.01
>12201224425607513529.8533.4831.76
Total38543982414718933638.1043.0540.78
Language: English
Page range: 155 - 160
Submitted on: Sep 14, 2020
|
Accepted on: Mar 26, 2021
|
Published on: Apr 23, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2021 Jin-yu Zhao, Yi-zhou Du, Ya-ping Song, Peng Zhou, Yue-feng Chu, Jun-yuan Wu, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.