Skip to main content
Have a personal or library account? Click to login
Echinacea purpurea extract (cichoric acid) exerts an anti-inflammatory effect on yak PBMCs and regulates the TLR4 signalling pathway Cover

Echinacea purpurea extract (cichoric acid) exerts an anti-inflammatory effect on yak PBMCs and regulates the TLR4 signalling pathway

Open Access
|Mar 2021

Figures & Tables

Fig. 1

Effects of LPS on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 2

Effects of LPS and CA on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 3

Effects of CA on the content of inflammatory-related factors in yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 secretion of PBMCs in yak was detected by ELISA. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 4

Effects of CA on inflammatory factor mRNA expression of yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. The RNA expression of IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 was measured. * – P < 0.05; ** – P <0.01. P values are compared with the control group. # –P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 5

Effect of CA on the TLR4 signalling pathway in yak PBMCs. A– Expression of MyD88, NF-κB, TRAF6 and IRF5 mRNA detected by RT-PCR. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group. B – SDS-PAGE electrophoresis diagram of key factors of the TLR4 pathway in yak PBMCs. C – Protein expression of MyD88, NF-κB, TRAF6 and IRF5 detected by Western blotting analysis. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group

Gene primer sequences

GeneForward primerReverse primer
GAPDHATCTGACCTGCCGCCTGGAGGACGCCTGCTTCACCACCTTC
INF-γCCGAGCGTGGAGGATCATTGCCCAACGAGGCACAGCAGGATG
TNF-αCTGGCGGAGGAGGTGCTCTCGGAGGAAGGAGAAGAGGCTGAGG
IL-10ACCAGCCACCAATGTTGCTCATACCTTCTCCACCGCCTTGCTCTTG
IL-6CACTGACCTGCTGGAGAAGATGCCCGAATAGCTCTCAGGCTGAACTG
IL-1βGAGTGCCATCCTTCTGTCAAGTCCAGCCTACCAAGCTCCTCCATCC
IL-8CATGGATGGAGGAGCCTGGTAGGCTGCTAAGTCGCTTCAGTCGTGTC
NF-κBACAAGCCTGTCACAGCCAACATGTGATGGTGAAGGCTCAGGAGGTG
IRF5TGCTGCCTCTGACCGACCTGCGCACTTGCTCCAGGCTCAC
MyD88TATCGGCTGAAGTTGTGCGTGTCTCAGAGACCACCACCACCATCC
Language: English
Page range: 109 - 115
Submitted on: Jul 6, 2020
Accepted on: Feb 23, 2021
Published on: Mar 9, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2021 Cai-hua Xue, Shun-xian A, Meng-jie Wang, Qiang Wu, Jia-hua Liu, Long-fei Zhang, Yun Wu, Hua Wu, Sha-tuo Chai, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.