Fig. 1
Fig. 2
Fig. 3
Prevalence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area
| Potential propensity factor | Number of examined camels | Mean number of parasite species in co-infection | Mean EPG | |
|---|---|---|---|---|
| Young camels (>2 years) | 106 | 6 ± 1.6a | 1046 ± 87.2a | |
| Age | Sub-adult camels (2–6 years) | 139 | 7 ± 1.8a | 779 ± 39.6a |
| Adult camels (>6 years) | 117 | 11 ± 1.5b | 462 ± 40.7b | |
| Sex | Male | 206 | 9 ± 1.2a | 901 ± 85.5a |
Primers used in the study
| Primer | Nucleotide sequence (5′ to 3′) | Target gene | Size of amplified product (bp) |
|---|---|---|---|
| FP1 | AGGTATCTGTAGGTGAACCTGC | Ribosomal ITS1 of Haemonchus contortus | 810 |
| RP1 | ATACAAATGATAAAAGAACATC | ||
| FP2 | GAGAGGACTGCGGACTGCTGTA | Ribosomal ITS1 of Trichostrongylus spp. | 240 |
| RP2 | CTCACACACAGAGCTCTAACGG | ||
| FR3 | CTGCGGAAGGATCATTGTCGAA | Ribosomal ITS1 of Chabertia ovina | 475 |
| RP3 | ACTCTAAGCGTCTGCAATTCGT | ||
| FR4 | TGTACACACCGCCCGTCGCTGT | Ribosomal ITS1 of Ostertagia spp. | 475 |
| RP4 | TGACAACCAGGTACCGTACACA | ||
| FR5 | GGACTGCGGACTGCTGTATCGA | Ribosomal ITS1 of Bunostomum spp. | 475 |
| RP5 | TGTTAAACGTAAAAAATTGGTT |
Summary statistics of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area
| Parasite species | Infection rate (%) | Mean EPG | Length of egg (μm) | Width of egg (μm) |
|---|---|---|---|---|
| Ostertagia spp. | 100 (362/362) | 298 ± 57.1 | 71.25 ± 9.12 | 36.44 ± 4.57 |
| Trichostrongylus spp. | 98.1 (355/362) | 105 ± 36.2 | 82.24 ± 10.83 | 39.63 ± 3.53 |
| Haemonchus contortus | 88.1 (319/362) | 176 ± 62.5 | 75.65 ± 5.78 | 46.35 ± 7.88 |
| Nematodirus spp. | 87.3 (316/362) | 138 ± 41.8 | 241.36 ± 23.14 | 111.93 ± 18.51 |
| Marshallagia spp. | 80.4 (291/362) | 129 ± 38.7 | 182.89 ± 11.90 | 81.56 ± 7.42 |
| Trichuris spp. | 77.3 (281/362) | 93 ± 22.9 | 75.42 ± 6.57 | 35.27 ± 3.46 |
| Chabertia ovina | 18.2 (66/362) | 71 ± 10.4 | 89.24 ± 8.33 | 52.26 ± 5.72 |
| Bunostomum spp. | 9.9 (36/362) | 45 ± 14.8 | 88.67 ± 7.91 | 48.22 ± 2.35 |
| Strongyloides papillosus | 33.1 (120/362) | 113 ± 8.7 | 51.78 ± 8.75 | 30.58 ± 5.67 |
| Thysaniezia ovilla | 60.8 (220/362) | 126 ± 29.4 | 25.18 ± 3.15 | 22.34 ± 2.78 |
| Moniezia expansa | 42.3 (153/362) | 103 ± 41.1 | 63.13 ± 4.32 | 46.86 ± 5.31 |
| Dicrocoelium spp. | 62.4 (226/362) | 82 ± 6.8 | 39.19 ± 4.74 | 31.25 ± 3.16 |
| Fasciola hepatica | 24.6 (89/362) | 20 ± 13.5 | 140.55 ± 7.68 | 84.54 ± 8.12 |
| Hasstilesia ovis | 91.7(332/362) | 56 ± 17.5 | 30.12 ± 3.81 | 18.32 ± 1.72 |
| Eimeria spp. | 73.5 (266/362) | 94 ± 16.2 | 34.18 ± 2.32 | 22.17 ± 1.72 |