Skip to main content
Have a personal or library account? Click to login
Occurrence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area in China Cover

Occurrence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area in China

Open Access
|Nov 2020

Figures & Tables

Table 1

Primers used in the study

PrimerNucleotide sequence (5′ to 3′)Target geneSize of amplified product (bp)
FP1AGGTATCTGTAGGTGAACCTGCRibosomal ITS1 of Haemonchus contortus810
RP1ATACAAATGATAAAAGAACATC
FP2GAGAGGACTGCGGACTGCTGTARibosomal ITS1 of Trichostrongylus spp.240
RP2CTCACACACAGAGCTCTAACGG
FR3CTGCGGAAGGATCATTGTCGAARibosomal ITS1 of Chabertia ovina475
RP3ACTCTAAGCGTCTGCAATTCGT
FR4TGTACACACCGCCCGTCGCTGTRibosomal ITS1 of Ostertagia spp.475
RP4TGACAACCAGGTACCGTACACA
FR5GGACTGCGGACTGCTGTATCGARibosomal ITS1 of Bunostomum spp.475
RP5TGTTAAACGTAAAAAATTGGTT
Fig. 1

Morphological characteristics of eggs of different parasitic worms in the faeces of camels in the Tianshan Mountains pastoral area

A – Nematodirus spp.; B – Marshallagia spp.; C – Fasciola hepatica; D – Chabertia ovina; E – Bunostomum spp.; F – Moniezia expansa; G – Haemonchus contortus; H – Trichostrongylus spp.; I – Ostertagia spp.; J – Trichuris spp.; K – Strongyloides papillosus; L – Dicrocoelium spp.; M – Eimeria spp.; N – Thysaniezia ovilla; O – Hasstilesia ovis

Fig. 2

Molecular detection of nematode eggs with similar morphological structure in camel faeces

M – DNA maker DL1000 (1000, 700, 500, 400, 300, 200, 100 bp); Lanes 1, 4, 5, 6, and 10 – negative results; Lane 2 – Haemonchus contortus; Lane 3 – Trichostrongylus spp.; Lane 7 – Chabertia ovina; Lane 8 – Ostertagia spp.; Lane 9 – Bunostomum spp.

Table 2

Summary statistics of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area

Parasite speciesInfection rate (%)Mean EPGLength of egg (μm)Width of egg (μm)
Ostertagia spp.100 (362/362)298 ± 57.171.25 ± 9.1236.44 ± 4.57
Trichostrongylus spp.98.1 (355/362)105 ± 36.282.24 ± 10.8339.63 ± 3.53
Haemonchus contortus88.1 (319/362)176 ± 62.575.65 ± 5.7846.35 ± 7.88
Nematodirus spp.87.3 (316/362)138 ± 41.8241.36 ± 23.14111.93 ± 18.51
Marshallagia spp.80.4 (291/362)129 ± 38.7182.89 ± 11.9081.56 ± 7.42
Trichuris spp.77.3 (281/362)93 ± 22.975.42 ± 6.5735.27 ± 3.46
Chabertia ovina18.2 (66/362)71 ± 10.489.24 ± 8.3352.26 ± 5.72
Bunostomum spp.9.9 (36/362)45 ± 14.888.67 ± 7.9148.22 ± 2.35
Strongyloides papillosus33.1 (120/362)113 ± 8.751.78 ± 8.7530.58 ± 5.67
Thysaniezia ovilla60.8 (220/362)126 ± 29.425.18 ± 3.1522.34 ± 2.78
Moniezia expansa42.3 (153/362)103 ± 41.163.13 ± 4.3246.86 ± 5.31
Dicrocoelium spp.62.4 (226/362)82 ± 6.839.19 ± 4.7431.25 ± 3.16
Fasciola hepatica24.6 (89/362)20 ± 13.5140.55 ± 7.6884.54 ± 8.12
Hasstilesia ovis91.7(332/362)56 ± 17.530.12 ± 3.8118.32 ± 1.72
Eimeria spp.73.5 (266/362)94 ± 16.234.18 ± 2.3222.17 ± 1.72
Fig. 3

Mixed infection with different species of gastrointestinal parasite in camels in the Tianshan Mountains pastoral area

Table 3

Prevalence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area

Potential propensity factorNumber of examined camelsMean number of parasite species in co-infectionMean EPG
Young camels (>2 years)1066 ± 1.6a1046 ± 87.2a
AgeSub-adult camels (2–6 years)1397 ± 1.8a779 ± 39.6a
Adult camels (>6 years)11711 ± 1.5b462 ± 40.7b
SexMale
Female
206
156
9 ± 1.2a
10 ± 1.9a
901 ± 85.5a
1027 ± 101.2a

[i] Different letters in same column mean significant difference (P < 0.05)

DOI: https://doi.org/10.2478/jvetres-2020-0071 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 509 - 515
Submitted on: Apr 21, 2020
Accepted on: Oct 12, 2020
Published on: Nov 6, 2020
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2020 Zhang Guowu, Zhang Kai, Wang Xifeng, Ji Chunhui, Ning Chengcheng, Zhao Yue, Qiao Jun, Meng Qingling, Zhang Xingxing, Cai Kuojun, Zhang Jinsheng, Zhang Zaichao, Cai Xuepeng, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.