Fig. 1

Fig. 2

Species distribution of fresh dropping samples and PCR results
| Companion birds (n) | Age (months) | Number of samples by bird seller | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A A to M indicate thirteen different bird sellers | B | C | D | E | F | G | H | I | J | K | L | M | ||
| Agapornis sp. (3) | 60 | 3 | ||||||||||||
| A. ararauna (1) | 48 | 1 | ||||||||||||
| M. undulatus (106) | 2–12 | 11 | 5 | 5 | 10 | 2 | 7 | 10 | 15 | 10 | 8 | 8 | 7 | 8 |
| N. hollandicus (2) | 24 | 2 | ||||||||||||
| P. erithacus (1) | 36 | 1 | ||||||||||||
| Total (113) | 12 | 5 | 5 | 14 | 2 | 9 | 10 | 15 | 10 | 8 | 8 | 7 | 8 | |
Primers used in the study, target region, and amplicon lengths
| Primer names | Sequence (5′–3′) | Target region | Size (bp) | References |
|---|---|---|---|---|
| BFDV-seq-F | TTAACAACCCTACAGACGGCGA | replication associated | ||
| BFDV-seq-R | GGCGGAGCATCTCGCAATAAG | protein (rep) gene | 605 | (21) |
| APV-Ot-2,105-F | CAGCACAGAGGTACCGTGTT | VP1 gene | 831 | (1) |
| APV-Ot-2,846-R | ATCAGAGCCCTGCATGCTTT |
Species distribution of dropping swab samples positive for APV, PBFDV, and APV & BFDV by PCR
| Companion bird | Only APV Positive/total examined (%) | Only BFDV Positive/total examined (%) | APV & BFDV Positive/total examined (%) |
|---|---|---|---|
| Agapornis sp. | 0/3 (0) | 0/3 (0) | 0/3 (0) |
| A. ararauna | 0/1 (0) | 0/1 (0) | 0/1 (0) |
| M. undulatus | 40/106 (37.7) | 11/106 (10.4) | 14/106 (13.2) |
| N. hollandicus | 1/2 (50) | 1/2 (50) | 0/2 (0) |
| P. erithacus | 0/1 (0) | 0/1 (0) | 0/1 (0) |
| Total | 41/113 (36.3) | 12/113 (10.6) | 14/113 (12.4) |