Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines

Pınar Alkım Ulutaş; Funda Kıral; Bülent Ulutaş; Gamze Sevri Ekren Aşıcı

doi:10.2478/jvetres-2020-0063

Table 1

Primer sequences used for qRT-PCR

NCBI reference sequence	Gene	Forward primer (5´→3´)	Reverse primer (5´→3´)
NM_001003142.2	GAPDH	AGTCAAGGCTGAGAACGGGAAA	TCCACAACATACTCAGCACCAGC

NM_001002949.1	BCL2	CATGCCAAGAGGGAAACACCAGAA	GTGCTTTGCATTCTTGGATGAGGG

NM_001003011.1	BAX	TTCCGAGTGGCAGCTGAGATGTTT	TGCTGGCAAAGTAGAAGAGGGCAA

Table 2

Effect of nanoclinoptilolite on cell viability of canine D-17 OSA. The results represent the mean ± standard deviation

Nanoclinoptilolite concentration (μg/mL)	24 h			48 h			72 h
	% Viability $\bar{X} \pm S_{_{x}^{-}}$	X	P	% Viability $\bar{X} \pm S_{_{x}^{-}}$	X	P	% Viability $\bar{X} \pm S_{_{x}^{-}}$	X	P
Control	100 ± 5.66	a		100 ± 6.09	a		100 ± 3.15	a
10	92.62 ± 8.29	a	>0.05	60.24 ± 5.50	b	***	56.08 ± 3.57	b	***
20	81.45 ± 5.11	b	***	48.50 ± 1.83	c	***	31.95 ± 2.24	c	***
30	69.35 ± 2.24	c	***	37.27 ± 2.25	d	***	23.23 ± 6.89	cd	***
40	61.66 ± 3.01	cd	***	30.12 ± 2.23	de	***	19.87 ± 5.45	de	***
50	56.88 ± 2.45	de	***	26.16 ± 4.14	ef	***	15.14 ± 7.29	def	***
75	51.92 ± 2.02	def	***	21.19 ± 0.42	fg	***	12.02 ± 1.70	ef	***
100	48.08 ± 1.87	ef	***	19.14 ± 1.55	fg	***	10.31 ± 0.26	ef	***
150	44.60 ± 1.80	f	***	18.19 ± 0.53	g	***	9.41 ± 0.15	f	***
200	43.80 ± 3.91	f	***	18.00 ± 0.74	g	***	9.92 ± 0.28	f	***

* P < 0.05; ** P < 0.01; *** P < 0.001 compared to control

a Statistical difference between groups with different letters in the same column is significant

b Statistical difference between groups with different letters in the same column is significant

c Statistical difference between groups with different letters in the same column is significant

d Statistical difference between groups with different letters in the same column is significant

cd Statistical difference between groups with different letters in the same column is significant

de Statistical difference between groups with different letters in the same column is significant

ef Statistical difference between groups with different letters in the same column is significant

def Statistical difference between groups with different letters in the same column is significant

fg Statistical difference between groups with different letters in the same column is significant

ef Statistical difference between groups with different letters in the same column is significant

fg Statistical difference between groups with different letters in the same column is significant

ef Statistical difference between groups with different letters in the same column is significant

f Statistical difference between groups with different letters in the same column is significant

g Statistical difference between groups with different letters in the same column is significant

f Statistical difference between groups with different letters in the same column is significant

g Statistical difference between groups with different letters in the same column is significant

f Statistical difference between groups with different letters in the same column is significant

Table 3

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 24 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

	% live	% apoptotic	% dead
Control	92.3 ± 2.36a	7.62 ± 1.83a	0.12 ± 0.017a
10 μg/mL	93.65 ± 1.61a	5.78 ± 0.87a	0.57 ± 0.18b
20 μg/mL	91.57 ± 0.43a	7.60 ± 0.32a	0.95 ± 0.004 c
30 μg/mL	86.65 ± 0.41b	12.77 ± 0.51b	0.52 ± 0.07b
P	0.020	0.031	0.05

a Statistical difference between groups with different letters in the same column is significant

b Statistical difference between groups with different letters in the same column is significant

a Statistical difference between groups with different letters in the same column is significant

c Statistical difference between groups with different letters in the same column is significant

b Statistical difference between groups with different letters in the same column is significant

Table 4

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 48 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

	% live	% apoptotic	% dead
Control	92.63 ± 0.63a	7.25 ± 0.73a	0.22 ± 0.04a
10 g/mL	91.3 ± 0.41a	8.53 ± 0.93a	0.17 ± 0.02a
20 μg/mL	85.35 ± 0.30b	14.2 ± 0.5b	0.45 ± 0.09a
30 μg/mL	23.8 ± 1.96c	23.8 ± 1.93c	1.2 ± 0.03b
P	0.020	0.031	0.05

a Statistical difference between groups with different letters in the same column is significant

b Statistical difference between groups with different letters in the same column is significant

a Statistical difference between groups with different letters in the same column is significant

c Statistical difference between groups with different letters in the same column is significant

b Statistical difference between groups with different letters in the same column is significant

Table 5

Effect of nanoclinoptilolite on the Bax/Bcl-2 ratio in canine D-17 OSA cells for 24 and 48 h (* P<0.05)

Nanoclinoptilolite concentration	24 h	48 h
10 μg/mL	0.44	3.00
20 μg/mL	0.44	8.88
30 μg/mL	0.75	14.24

Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines

Figures & Tables

Table 1

Fig. 1

Table 2

Fig. 2

Table 3

Table 4

Fig. 3

Table 5

Paradigm

My account