Skip to main content
Have a personal or library account? Click to login
Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines Cover

Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines

Open Access
|Oct 2020

Figures & Tables

Fig. 1

Effect of nanoclinoptilolite on cell viability of canine OSA D-17

Fig. 2

Caspase-3 and -7 activity after treatment with different concentrations of nanoclinoptilolite in canine D-17 OSA cells. Treatment over 24 h: A – control; B – 10 μg/mL; C– 20 μg/mL; D – 30 μg/mL. Treatment over 48 h: E – control; F – 10 μg/mL; G – 20 μg/mL; H– 30 μg/mL

Fig. 3

Effect of nanoclinoptilolite on the BAX/BCL-2 ratio in canine D-17 OSA cells

Primer sequences used for qRT-PCR

NCBI reference sequenceGeneForward primer (5´→3´)Reverse primer (5´→3´)
NM_001003142.2GAPDHAGTCAAGGCTGAGAACGGGAAATCCACAACATACTCAGCACCAGC
NM_001002949.1BCL2CATGCCAAGAGGGAAACACCAGAAGTGCTTTGCATTCTTGGATGAGGG
NM_001003011.1BAXTTCCGAGTGGCAGCTGAGATGTTTTGCTGGCAAAGTAGAAGAGGGCAA

Effect of nanoclinoptilolite on cell viability of canine D-17 OSA_ The results represent the mean ± standard deviation

Nanoclinoptilolite concentration (μg/mL)24 h48 h72 h
% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP% Viability X¯±Sx$\overline{X}\pm {{S}_{_{x}^{-}}}$XP
Control100 ± 5.66

Statistical difference between groups with different letters in the same column is significant

100 ± 6.09

Statistical difference between groups with different letters in the same column is significant

100 ± 3.15

Statistical difference between groups with different letters in the same column is significant

1092.62 ± 8.29

Statistical difference between groups with different letters in the same column is significant

>0.0560.24 ± 5.50

Statistical difference between groups with different letters in the same column is significant

***56.08 ± 3.57

Statistical difference between groups with different letters in the same column is significant

***
2081.45 ± 5.11

Statistical difference between groups with different letters in the same column is significant

***48.50 ± 1.83

Statistical difference between groups with different letters in the same column is significant

***31.95 ± 2.24

Statistical difference between groups with different letters in the same column is significant

***
3069.35 ± 2.24

Statistical difference between groups with different letters in the same column is significant

***37.27 ± 2.25

Statistical difference between groups with different letters in the same column is significant

***23.23 ± 6.89

Statistical difference between groups with different letters in the same column is significant

***
4061.66 ± 3.01

Statistical difference between groups with different letters in the same column is significant

***30.12 ± 2.23

Statistical difference between groups with different letters in the same column is significant

***19.87 ± 5.45

Statistical difference between groups with different letters in the same column is significant

***
5056.88 ± 2.45

Statistical difference between groups with different letters in the same column is significant

***26.16 ± 4.14

Statistical difference between groups with different letters in the same column is significant

***15.14 ± 7.29

Statistical difference between groups with different letters in the same column is significant

***
7551.92 ± 2.02

Statistical difference between groups with different letters in the same column is significant

***21.19 ± 0.42

Statistical difference between groups with different letters in the same column is significant

***12.02 ± 1.70

Statistical difference between groups with different letters in the same column is significant

***
10048.08 ± 1.87

Statistical difference between groups with different letters in the same column is significant

***19.14 ± 1.55

Statistical difference between groups with different letters in the same column is significant

***10.31 ± 0.26

Statistical difference between groups with different letters in the same column is significant

***
15044.60 ± 1.80

Statistical difference between groups with different letters in the same column is significant

***18.19 ± 0.53

Statistical difference between groups with different letters in the same column is significant

***9.41 ± 0.15

Statistical difference between groups with different letters in the same column is significant

***
20043.80 ± 3.91

Statistical difference between groups with different letters in the same column is significant

***18.00 ± 0.74

Statistical difference between groups with different letters in the same column is significant

***9.92 ± 0.28

Statistical difference between groups with different letters in the same column is significant

***

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 24 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

% live% apoptotic% dead
Control92.3 ± 2.36

Statistical difference between groups with different letters in the same column is significant

7.62 ± 1.83

Statistical difference between groups with different letters in the same column is significant

0.12 ± 0.017

Statistical difference between groups with different letters in the same column is significant

10 μg/mL93.65 ± 1.61

Statistical difference between groups with different letters in the same column is significant

5.78 ± 0.87

Statistical difference between groups with different letters in the same column is significant

0.57 ± 0.18

Statistical difference between groups with different letters in the same column is significant

20 μg/mL91.57 ± 0.43

Statistical difference between groups with different letters in the same column is significant

7.60 ± 0.32

Statistical difference between groups with different letters in the same column is significant

0.95 ± 0.004

Statistical difference between groups with different letters in the same column is significant

30 μg/mL86.65 ± 0.41

Statistical difference between groups with different letters in the same column is significant

12.77 ± 0.51

Statistical difference between groups with different letters in the same column is significant

0.52 ± 0.07

Statistical difference between groups with different letters in the same column is significant

P0.0200.0310.05

Effect of nanoclinoptilolite on the Bax/Bcl-2 ratio in canine D-17 OSA cells for 24 and 48 h (* P<0_05)

Nanoclinoptilolite concentration24 h48 h
10 μg/mL0.443.00
20 μg/mL0.448.88
30 μg/mL0.7514.24

Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 48 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells

% live% apoptotic% dead
Control92.63 ± 0.63

Statistical difference between groups with different letters in the same column is significant

7.25 ± 0.73

Statistical difference between groups with different letters in the same column is significant

0.22 ± 0.04

Statistical difference between groups with different letters in the same column is significant

10 g/mL91.3 ± 0.41

Statistical difference between groups with different letters in the same column is significant

8.53 ± 0.93

Statistical difference between groups with different letters in the same column is significant

0.17 ± 0.02

Statistical difference between groups with different letters in the same column is significant

20 μg/mL85.35 ± 0.30

Statistical difference between groups with different letters in the same column is significant

14.2 ± 0.5

Statistical difference between groups with different letters in the same column is significant

0.45 ± 0.09

Statistical difference between groups with different letters in the same column is significant

30 μg/mL23.8 ± 1.96

Statistical difference between groups with different letters in the same column is significant

23.8 ± 1.93

Statistical difference between groups with different letters in the same column is significant

1.2 ± 0.03

Statistical difference between groups with different letters in the same column is significant

P0.0200.0310.05
Language: English
Page range: 589 - 596
Submitted on: Dec 6, 2019
Accepted on: Sep 23, 2020
Published on: Oct 8, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Pınar Alkım Ulutaş, Funda Kıral, Bülent Ulutaş, Gamze Sevri Ekren Aşıcı, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.