Skip to main content
Have a personal or library account? Click to login
Prevalence and characterisation of class 1 and 2 integrons in multi-drug resistant Staphylococcus aureus isolates from pig farms in Chongqing, China Cover

Prevalence and characterisation of class 1 and 2 integrons in multi-drug resistant Staphylococcus aureus isolates from pig farms in Chongqing, China

Open Access
|Sep 2020

Figures & Tables

Table 1

Primers used in this study

PrimerTarget geneSequence (5′–3′)Product size (bp)
intl1-FintI-1CCTCCCGCACGATGATC280
intl1-RTCCACGCATCGTCAGGC
intI2-FTTATTGCTGGGATTAGGC
intI2-RintI-2ACGGCTACCCTCTGTTATC233
intI3-FintI-3AGTGGGTGGCGAATGAGTG600
intI3-RTGTTCTTGTATCGGCAGGTG
intl1-kvariable region 1ACCGAAACCTTGCGCTCGTVariable
lnBAAGCAGACTTGACCTGAT
hep74CGGGATCCCGGACGGCATGCAC
variable region 2GATTTGTAVariable
hep51GATGCCATCGCAAGTACGAG
Table 2

The prevalence of pig farm-derived S. aureus

Sample sourcesNumber of samples from each sourceNumber of positive isolates (%)Number of MRSA strains among the positive isolates (%)
Faeces42643 (10.1%)35 (81.4%)
Floor21511 (5.1%)9 (81.8%)
Water223 (13.6%)2 (66.7%)
Feed206 (30.0%)6 (100%)
Air415 (12.2%)5 (100%)
Total72468 (9.4%)57 (83.8%)
Table 3

Antibiotic-resistant phenotypes and genotypes of S. aureus in this study

Antimicrobial subclassAntimicrobial agentPhenotypes (n = 68)Genotypes (number of isolates containing different resistance gene cassettes)
Number of resistant isolates (%)Number of sensitive isolatesClass 1 integron (n = 60)Class 2 integron (n = 68)
aadA1c or aadA1dfrA1blaTEM-1
Penicillin68 (100)---58
β-lactamsOxacillin60 (88.2)---50
-8--8
TetracyclinesTetracycline68 (100)----
MacrolidesErythromycin68 (100)----
46 (67.6)----
PhenicolsChloramphenicol-22---
Folate pathway15 (22.1)--2-
inhibitorsTrimethoprim-sulfamethoxazole-53-12-
7 (10.3)----
LincosamidesClindamycin-61---
RifamycinsRifamycin2 (2.9)----
-66---
AminoglycosidesGentamicin1 (1.5)-1--
-6739--
Ciprofloxacin1 (1.5)----
Quinolones-67---
Levofloxacin1 (1.5)----
-67---
NitrofuransNitrofurantoin-68---
GlycopeptidesTeicoplanin-68---
Table 4

Comparison of detection rates of class 1 and 2 integrons in plasmid and genomic DNA in pig farm-derived S. aureus

Types of DNAClass 1 integronsClass 2 integrons
Number of positive (negative) strainsPositive rate (%)Number of positive (negative) strainsPositive rate (%)
Genomic DNA25 (43)36.831 (37)45.6
Plasmid DNA60 (8)88.268 (0)100
χ238.4350.83
P-value<0.001<0.001
Fig. 1

Schematic representation of the various cassette arrays found in class 1 and class 2 integrons. Arrows display the open reading frames of the different genes. All aadA1c and aadA1 genes are represented as orange arrows; 5′CS, 3′CS, qacEΔ1, and sul1 genes as light grey; dfrA1 as light blue; and blaTEM-1 genes as white

Table 5

Different types of gene cassette amplicons among the integron-bearing S. aureus

Types of integronsNumber of isolates carrying different cassettes (%)Approximate sizes of amplicon (bp)Inserted cassette(s)
25 (41.7%)1,200aadA1c
Integron 11 (1.7%)2,000dfrA1 + aadA1
14 (23.3%)1,200, 2,000aadA1c, dfrA1 + aadA1
Integron 258 (85.3%)700blaTEM-1
DOI: https://doi.org/10.2478/jvetres-2020-0061 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 381 - 386
Submitted on: Mar 4, 2020
Accepted on: Aug 24, 2020
Published on: Sep 16, 2020
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2020 Chao Ye, Fengqing Hou, Dongyi Xu, Qingyuan Huang, Xia Chen, Zheng Zeng, Yuanyi Peng, Rendong Fang, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.