Have a personal or library account? Click to login
IFNγ production profile in turkeys of different immunological status after TRT vaccination Cover

IFNγ production profile in turkeys of different immunological status after TRT vaccination

Journal of Veterinary Research
Volume 64 (2020): Issue 2 (June 2020)
By: Marcin Śmiałek,  Bartłomiej Tykałowski,  Daria Dziewulska,  Joanna Kowalczyk and  Andrzej Koncicki  
Open Access
|Jun 2020

Figures & Tables

Fig. 1

Summary of mean relative IFNγ gene expression in splenic mononuclear cells on different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B). The relative expression of the IFNγ gene was calculated using the 2−ΔΔCt method normalised to efficiency corrections, expression levels of the reference gene coding GAPDH and adequate control groups. Bars represent mean IFN gamma expression level against its expression in the adequate control group * Significant differences at different DPV (t-test, P < 0.05)
Summary of mean relative IFNγ gene expression in splenic mononuclear cells on different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B). The relative expression of the IFNγ gene was calculated using the 2−ΔΔCt method normalised to efficiency corrections, expression levels of the reference gene coding GAPDH and adequate control groups. Bars represent mean IFN gamma expression level against its expression in the adequate control group * Significant differences at different DPV (t-test, P < 0.05)

Fig. 2

Summary of mean contribution of anti-aMPV IFNγ-secreting cells within splenic mononuclear cells at different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B) in relation to the mean contribution of anti-aMPV IFNγ-secreting cells in the spleen of adequate control birds (not vaccinated)* Significant differences in vaccinated groups of birds in comparison to adequate control groups, at different DPV (t-test, P < 0.05)
Summary of mean contribution of anti-aMPV IFNγ-secreting cells within splenic mononuclear cells at different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B) in relation to the mean contribution of anti-aMPV IFNγ-secreting cells in the spleen of adequate control birds (not vaccinated)* Significant differences in vaccinated groups of birds in comparison to adequate control groups, at different DPV (t-test, P < 0.05)

Mean percentage of CD8+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV

Mean percentage of CD8+IFNγ+ cells ± SD
ExperimentGroup3 DPV7 DPV10 DPV
IMDA+0/V1.14 ± 0.561.4 ± 0.365.45 ± 2.21*
MDA+0/NV0.64 ± 0.111.48 ± 0.81.21 ± 0.46
IIMDA−0/V2.82 ± 1.67*1.37 ± 0.831.17 ± 0.15
MDA−0/NV0.5 ± 0.350.39 ± 0.021.08 ± 0.18
IIIMDA+14/V4.26 ± 1.963.57 ± 0.423.69 ± 1.46*
MDA+14/NV1.55 ± 0.732.81 ± 0.831.39 ± 0.42
IVMDA−14/V1.65 ± 0.112.79 ± 1.231.55 ± 0.89
MDA−14/NV0.91 ± 0.162.01 ± 0.631.32 ± 0.78

Serum maternally derived anti-aMPV IgY antibody levels on the days of aMPV/A vaccination of turkeys in experiments I–IV

Bird MDA statusMean MDA S/P ratio ± SD at the time of vaccination
0 DOL14 DOL
MDA+6.63 ± 2.532.30 ± 1.22
(experiment I)(experiment III)
MDA−0.00 ± 0.000.00 ± 0.00
(experiment II)(experiment IV)

Mean percentage of CD4+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV

ExperimentGroupMean percentage of CD4+IFNγ+ cells ± SD
3 DPV7 DPV10 DPV
IMDA+0/V1.11 ± 0.332.66 ± 0.97*3.34 ± 1.55*
MDA+0/NV1.26 ± 0.670.91 ± 0.320.97 ± 0.18
IIMDA−0/V2.27 ± 0.72*1.65 ± 1.081.01 ± 0.39
MDA−0/NV0.94 ± 0.320.39 ± 0.110.79 ± 0.40
IIIMDA+14/V5.21 ± 2.56*4.69 ± 3.694.21 ± 1.89*
MDA+14/NV1.50 ± 0.011.32 ± 0.591.16 ± 0.91
IVMDA−14/V1.68 ± 0.20*2.71 ± 1.901.60 ± 0.52
MDA−14/NV0.46 ± 0.281.28 ± 0.300.50 ± 0.33

Primers used for real time PCR

PrimerSequence 5”–3”Fragment size (bp)GenBank accession no.
INFγ FCTGACAAGTCAAAGCCGCAC
137XM_003202048.3
INFγ RAGTCATTCATCTGAAGCTTGGC
GAPDH FCCCTGAGCTCAATGGGAAGC
125NM_001303179.1
GAPDH RTCAGCAGCAGCCTTCACTAC
DOI: https://doi.org/10.2478/jvetres-2020-0040 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 239 - 245
Submitted on: Mar 3, 2020
Accepted on: May 18, 2020
Published on: Jun 16, 2020
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
turkeys,
avian metapneumovirus,
maternally derived antibodies,
vaccination
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2020 Marcin Śmiałek, Bartłomiej Tykałowski, Daria Dziewulska, Joanna Kowalczyk, Andrzej Koncicki, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous articleVolume 64 (2020): Issue 2 (June 2020)Next article