Have a personal or library account? Click to login
Detection of koi herpesvirus (KHV) and carp oedema virus (CEV) in invasive round goby, Neogobius melanostomus Pallas, 1814, from Poland and Germany Cover

Detection of koi herpesvirus (KHV) and carp oedema virus (CEV) in invasive round goby, Neogobius melanostomus Pallas, 1814, from Poland and Germany

Open Access
|May 2020

Figures & Tables

Fig. 1

Electrophoretic separation of nested PCR products using KHV-Fn/KHV-Rn primers
Electrophoretic separation of nested PCR products using KHV-Fn/KHV-Rn primers

Fig. 2

Alignment of the obtained fragments of the KHV genome with the sequence submitted to GenBank under accession no. MG925491
Alignment of the obtained fragments of the KHV genome with the sequence submitted to GenBank under accession no. MG925491

Primer pairs used in the study to detect the KHV and CEV genomes

PrimerPrimer sequence (5′–3′)Product sizeReferences
KHV-FGACGACGCCGGAGACCTTGTG486 bpGilad et al. (9)
KHV-RCACAAGTTCAGTCTGTTCCTCAAC486 bpGilad et al. (9)
KHV-1FnCTCGCCGAGCAGAGGAAGCGC414 bpBergmann et al. (2)
KHV-1RnTCATGCTCTCCGAGGCCAGCGG414 bpBergmann et al. (2)
KHV-TK-FGGGTTACCTGTACGAG409 bpBercovier et al. (1)
KHV-TK-RCACCCAGTAGATTATGC409 bpBercovier et al. (1)
KHV-TK-FnCGTCGTGAGGAATACGACG348 bpUnpublished: Way in Kempter et al. (15)
KHV-TK-RnACCGTACAGCTCGTACTGG348 bpUnpublished: Way in Kempter et al. (15)
CEVforBATGGAGTATCCAAAGTACTTAG528 bpMatras et al. (18)
CEVrevJCTCTTCACTATTGTGACTT TG528 bpMatras et al. (18)
CEVforBintGTTATCAATGAAATTTGTGTATTG478 bpMatras et al. (18)
CEVrevJintTAGCAAAGTACTACCTCATCC478 bpMatras et al. (18)
Language: English
Page range: 247 - 251
Submitted on: Sep 25, 2019
Accepted on: May 14, 2020
Published on: May 27, 2020
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Yeonhwa Jin, Natalia Adamkowska, Jolanta Kiełpińska, Sven Michael Bergmann, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.