Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses

Orłowska, Anna; Iwan, Ewelina; Smreczak, Marcin; Rola, Jerzy

doi:10.2478/jvetres-2019-0067

Figures & Tables

A schematic of the RABV genome indicating position of five ORFs and primers

Gel analysis of representative purified products of amplification. A – first round (amplicons A, B, and C). B – second round (amplicons A1, A2, B1, B2, C1, and C2)

Primers employed for RT-PCR of field RABV samples

Amplicon	Primer name	Primer sequence 5′-3′	Location genome in RABV	Amplicon size
A	RVA_forward	ATGGATGCCGACAAGATTGTATT	1–23	4499
	RVA_reverse	CAGGGGGTGCATCAGGGGAAT	4478–4499
B	RVB_forward	ATCCCAGAGATGCAATCATCC	4418–4439	3860
	RVB_reverse	TGAGTAGAATGGTAGGACTGGCACC	8251–8276
C	RVC_forward	GAACCCAGATCTTGGAGAGAGAA	8172–8195	3631
	RVC_reverse	TTCGGATTCAAGATCTTGTTTT	11779–11801
A1	RVA_forward	as above		2267
	RVA1_reverse	TGGAATTTCTTGGAATTGGCCAAAGC	2241–2267
A2	RVA2_forward	GCTCATGACGGATCCAAACTCCC	2193–2216	2300
	RVA_reverse	as above
B1	RVB_forward	as above		2330
	RVB1_reverse	GATTCAGGAATCTCAAAGATTTGCGT	6724–6750
B2	RVB2_forward	TTGACTCCTTATATCAAAACCCAGA	6640–6665	1636
	RVB_reverse	as above
C1	RVC_forward	as above		2016
	RVC1_reverse	GTCATGGTTCTAGCTGCATGGCG	10155–10188
C2	RVC2_forward	ATGAGGCAGGTGCTGGGTG	10054–10073	1750
	RVC_reverse	as above

Details of samples in the comparative study of extraction methods_ RNA concentration, virus detection using real-time RT-PCR, and the number of reads obtained during whole-genome sequencing

	Group	Isolate	Sample origin	Collection date	Extraction method /RT-PCR procedure	Concentration of dsDNA after clean-up (Qubit HS) (ng/µL)	Verification of HTS library	Total number of reads	Number of viral reads	% of viral reads	Number of RABV reads (centrifuge)	Number of contigs	Average coverage
Direct metagenomic approach	I	767121097L	red fox	1997	A – QIAmp Viral RNA Mini	1.45	+	22,250	117	0.0525	3	-	-
		965180404L	red fox	2004	Kit/ RT + amplification of dsDNA with Klenow	1.06	+	15,282	67	0.438	0	-	-
		1045120899L	red fox	1999	fragment	1.08	+	158,723	496	0.31	8	-	-

	II	767121097L	red fox	1997		5.06	−	-	-		-	-	-
		965180404L	red fox	2004	B – Direct-zol RNA MiniPrep	1.21	+	160,354	1,1170	6.965	132	19	3.5
		1045120899L	red fox	1999	Zymo amplification Research/ of RT dsDNA + with	1.15	+	200,756	4,218	2.101	133	6	2.5
		1321180108L	red fox	2008	Klenow fragment	1.2	+	517,696	70,436	13.605	1,359	1	32
		1379120910L	red fox	2010		2.21	+	948,295	68,491	7.222	4,765	3	152

	III	1996181013L*	red fox	2013		1.18	+	839,440	47,118	5.613	28,116	1	495
		1992121113L	red fox	2013		13.4	+	423,115	1,417	0.334	62	9	2
		1739120912L	red fox	2012		2.93	+	4,216,387	14,103	0.334	657	1	15
		1679180512L*	red fox	2012	C – TRIzol/ chloroform/ethanol/	2.04	+	4,543,264	21,683	0.4772	2,935	1	71
		1577121111L	red fox	2011	RT+ amplification of dsDNA	4.28	+	1,058,492	5,313	0.05019	564	1	13
		1525180711L	red fox	2011	with Klenow fragment	4.38	+	849,062	2,023	0.238	23	3	1.5
		1391180910L	red fox	2010		3.86	+	2,401,009	8,487	0.3534	10	3	1
		EBLV-1	Eptesicus serotinus	2018			+	460,751	178,828	38.812	32,232	1	571

RABV-enriched approach	IV	1045120899L	as above	as above		16.8	+	2,697,616	2,560,850	94.930	1,342,569	1	38,039
		965180404L				56.5	+	2,951,939	2,765,165	93.67	1,503,424	1	41,961
		767121097L				76.6	+	3,106,953	2,871,569	92.42	1,686,411	1	41,697
		1379120910L				55.2	+	754,635	711,112	94.23	372,141	1	11,346
		1321180108L				25.1	+	1,115,667	951,915	85.322	557,949	3	5,962
		1525180711L				75.5	+	869,224	824,305	94.832	463,772	1	12,144
		1739120912L				48.5	+	682,577	645,311	94.54	362,514	1	9,500
		1996181013L*				65.4	+	760,390	718,626	94.507	423,322	1	10,144
		1577121111L				81.4	+	904,532	846,126	93.54	507,207	1	12,122
		1992121113L				75.9	+	978,751	922,826	94.286	525,370	1	13,536
		1391180910L				47.3	+	985,144	943,962	95.819	539,481	1	13,075
		2191180915L	red fox	2015	C – TRIzol/chloroform/	93	+	967,059	908,214	93.915	528,055	1	13,089
		1990121113L	red fox	2013	ethanol + virus enrichment	70.2	+	893,272	834,573	93.428	464,788	1	12,217
		2176120515L	red fox	2015		87.6	+	1,294,593	1,196,143	92.395	737,332	1	17,535
		2068180814L	red fox	2014		69.6	+	1,192,314	1,112,910	93.340	65,4514	1	16,190
		2214181115L	red fox	2015		87.6	+	1,230,082	1,140,045	92.680	709,820	1	16,316
		2067120814L	red fox	2014		62	+	1,265,627	1,150,880	90.933	703,662	1	17,091
		2066120814L	red fox	2014		68.4	+	1,934,161	1,741,947	90.062	1,062,064	1	25,144
		2226120916L	red fox	2016		84	+	1,133,386	1,011,316	89.229	633,117	1	14,546
		2235181116L	red fox	2016		103	+	1,947,768	1,828,286	93.865	1,119,736	1	26,791
		2236181216P	dog	2016		81.2	+	612,073	564,607	92.245	346,010	1	7,980
		2237120117L	red fox	2017		96.4	+	1,336,571	1,225,265	91.672	758,770	1	16,869
		2238181117K	cat	2017		62	+	1,034,833	918,601	88.768	562,828	1	12,576

Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses

Figures & Tables

Fig. 1

Fig. 2

Primers employed for RT-PCR of field RABV samples

Details of samples in the comparative study of extraction methods_ RNA concentration, virus detection using real-time RT-PCR, and the number of reads obtained during whole-genome sequencing

Paradigm

My account