Skip to main content
Have a personal or library account? Click to login
Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses Cover

Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses

Open Access
|Nov 2019

Figures & Tables

Fig. 1

A schematic of the RABV genome indicating position of five ORFs and primers

Fig. 2

Gel analysis of representative purified products of amplification. A – first round (amplicons A, B, and C). B – second round (amplicons A1, A2, B1, B2, C1, and C2)

Primers employed for RT-PCR of field RABV samples

AmpliconPrimer namePrimer sequence 5′-3′Location genome in RABVAmplicon size
ARVA_forwardATGGATGCCGACAAGATTGTATT1–234499
RVA_reverseCAGGGGGTGCATCAGGGGAAT4478–4499
BRVB_forwardATCCCAGAGATGCAATCATCC4418–44393860
RVB_reverseTGAGTAGAATGGTAGGACTGGCACC8251–8276
CRVC_forwardGAACCCAGATCTTGGAGAGAGAA8172–81953631
RVC_reverseTTCGGATTCAAGATCTTGTTTT11779–11801
A1RVA_forwardas above 2267
RVA1_reverseTGGAATTTCTTGGAATTGGCCAAAGC2241–2267
A2RVA2_forwardGCTCATGACGGATCCAAACTCCC2193–22162300
RVA_reverseas above
B1RVB_forwardas above 2330
RVB1_reverseGATTCAGGAATCTCAAAGATTTGCGT6724–6750
B2RVB2_forwardTTGACTCCTTATATCAAAACCCAGA6640–66651636
RVB_reverseas above
C1RVC_forwardas above 2016
RVC1_reverseGTCATGGTTCTAGCTGCATGGCG10155–10188
C2RVC2_forwardATGAGGCAGGTGCTGGGTG10054–100731750
RVC_reverseas above

Details of samples in the comparative study of extraction methods_ RNA concentration, virus detection using real-time RT-PCR, and the number of reads obtained during whole-genome sequencing

GroupIsolateSample originCollection dateExtraction method /RT-PCR procedureConcentration of dsDNA after clean-up (Qubit HS) (ng/µL)Verification of HTS libraryTotal number of readsNumber of viral reads% of viral readsNumber of RABV reads (centrifuge) Number of contigsAverage coverage
Direct metagenomic approachI767121097Lred fox1997A – QIAmp Viral RNA Mini1.45+22,2501170.05253 --
965180404Lred fox2004Kit/ RT + amplification of dsDNA with Klenow1.06+15,282670.4380 --
1045120899Lred fox1999fragment1.08+158,7234960.318 --

II767121097Lred fox1997 5.06-- - --
965180404Lred fox2004B – Direct-zol RNA MiniPrep1.21+160,3541,11706.965132 193.5
1045120899Lred fox1999Zymo amplification Research/ of RT dsDNA + with1.15+200,7564,2182.101133 62.5
1321180108Lred fox2008Klenow fragment1.2+517,69670,43613.6051,359 132
1379120910Lred fox2010 2.21+948,29568,4917.2224,765 3152

III1996181013L*red fox2013 1.18+839,44047,1185.61328,116 1495
1992121113Lred fox2013 13.4+423,1151,4170.33462 92
1739120912Lred fox2012 2.93+4,216,38714,1030.334657 115
1679180512L*red fox2012C – TRIzol/ chloroform/ethanol/2.04+4,543,26421,6830.47722,935 171
1577121111Lred fox2011RT+ amplification of dsDNA4.28+1,058,4925,3130.05019564 113
1525180711Lred fox2011with Klenow fragment4.38+849,0622,0230.23823 31.5
1391180910Lred fox2010 3.86+2,401,0098,4870.353410 31
EBLV-1Eptesicus serotinus2018 +460,751178,82838.81232,232 1571

RABV-enriched approachIV1045120899Las aboveas above 16.8+2,697,6162,560,85094.9301,342,569 138,039
965180404L 56.5+2,951,9392,765,16593.671,503,424 141,961
767121097L 76.6+3,106,9532,871,56992.421,686,411 141,697
1379120910L 55.2+754,635711,11294.23372,141 111,346
1321180108L 25.1+1,115,667951,91585.322557,949 35,962
1525180711L 75.5+869,224824,30594.832463,772 112,144
1739120912L 48.5+682,577645,31194.54362,514 19,500
1996181013L* 65.4+760,390718,62694.507423,322 110,144
1577121111L 81.4+904,532846,12693.54507,207 112,122
1992121113L 75.9+978,751922,82694.286525,370 113,536
1391180910L 47.3+985,144943,96295.819539,481 113,075
2191180915Lred fox2015C – TRIzol/chloroform/93+967,059908,21493.915528,055 113,089
1990121113Lred fox2013ethanol + virus enrichment70.2+893,272834,57393.428464,788 112,217
2176120515Lred fox2015 87.6+1,294,5931,196,14392.395737,332 117,535
2068180814Lred fox2014 69.6+1,192,3141,112,91093.34065,4514 116,190
2214181115Lred fox2015 87.6+1,230,0821,140,04592.680709,820 116,316
2067120814Lred fox2014 62+1,265,6271,150,88090.933703,662 117,091
2066120814Lred fox2014 68.4+1,934,1611,741,94790.0621,062,064 125,144
2226120916Lred fox2016 84+1,133,3861,011,31689.229633,117 114,546
2235181116Lred fox2016 103+1,947,7681,828,28693.8651,119,736 126,791
2236181216Pdog2016 81.2+612,073564,60792.245346,010 17,980
2237120117Lred fox2017 96.4+1,336,5711,225,26591.672758,770 116,869
2238181117Kcat2017 62+1,034,833918,60188.768562,828 112,576
Language: English
Page range: 471 - 479
Submitted on: Mar 6, 2019
Accepted on: Nov 4, 2019
Published on: Nov 16, 2019
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2019 Anna Orłowska, Ewelina Iwan, Marcin Smreczak, Jerzy Rola, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.