Table 1
Primer sequences
| Gene | Primer sequence (5′-3′) |
|---|---|
| TCCATTACTTGCCACAGCCC (forward) | |
| Beclin 1 | |
| CCCGATCAGAGTGAAGCTGT (reverse) | |
| ACAAGGACACAGCGACTCAG (forward) | |
| mTOR | |
| CGCGGAACCAGTGAGGTAAT (reverse) | |
| TACACGAGACCAGTCAACCTAAC (forward) | |
| p62 | |
| AGAAGATGCTTGTGCCGAG (reverse) | |
| GGTTTGAATATGAAGGCACACCA (forward) | |
| ATG5 | |
| TGTGATGTTCCAAGGAAGAGCTG (reverse) | |
| CAGAAACAGCCATCCCAGAG (forward) | |
| ATG12 | |
| GCCTTCAGCAGGATGTCAAT (reverse) | |
| TCTGGCAACCACACCTTCT (forward) | |
| β-Actin | |
| TGATCTGGGTCATCTTCTCAC (reverse) |
Fig. 1
Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Fig. 2
Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Fig. 3
Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus
Fig. 4
Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Fig. 5
Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Fig. 6
Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification