Skip to main content
Have a personal or library account? Click to login
Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs Cover

Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs

Open Access
|Oct 2018

Figures & Tables

Fig. 1

Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 2

Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 3

Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus

Fig. 4

Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 5

Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 6

Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification

Primer sequences

GenePrimer sequence (5′-3′)
TCCATTACTTGCCACAGCCC (forward)
Beclin 1
CCCGATCAGAGTGAAGCTGT (reverse)
ACAAGGACACAGCGACTCAG (forward)
mTOR
CGCGGAACCAGTGAGGTAAT (reverse)
TACACGAGACCAGTCAACCTAAC (forward)
p62
AGAAGATGCTTGTGCCGAG (reverse)
GGTTTGAATATGAAGGCACACCA (forward)
ATG5
TGTGATGTTCCAAGGAAGAGCTG (reverse)
CAGAAACAGCCATCCCAGAG (forward)
ATG12
GCCTTCAGCAGGATGTCAAT (reverse)
TCTGGCAACCACACCTTCT (forward)
β-Actin
TGATCTGGGTCATCTTCTCAC (reverse)
Language: English
Page range: 395 - 403
Submitted on: Mar 22, 2018
Accepted on: Aug 22, 2018
Published on: Oct 23, 2018
In partnership with: Paradigm Publishing Services

© 2018 Ge Bai, Hui Li, Yansong Ge, Qianzhen Zhang, Jiantao Zhang, Mingzi Chen, Tao Liu, Hongbin Wang, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.