Have a personal or library account? Click to login
Influence of the genetic makeup of common carp on the expression of iron-related genes during Trypanoplasma borreli infection Cover

Influence of the genetic makeup of common carp on the expression of iron-related genes during Trypanoplasma borreli infection

Open Access
|Oct 2018

Figures & Tables

Fig. 1

Common carp strain R3 (♦) and SA strain (■) mortality during Trypanoplasma borreli infection. Carp were infected with 2.6×105 of T. borreli

Fig. 2

Parasitaemia of common carp strain R3 (♦) and SA strain (■). Carp were infected with 2.6×105 of T. borreli. The values are means for blood samples from groups of n = 20 fish. Differences between carp strains are significant (P ≤ 0.05) for each time point except 0W

Fig. 3

Serum iron concentration (μg dL-1) in strains R3 (■) and SA (■) during T. borreli infection. The values are means ±SD for blood samples from groups of n = 10 fish. Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk

Fig. 4A

Transferrin receptor 1a expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between the strains were considered significant for P ≤ 0.05 in each time point and marked by a line

Fig. 4B

Transferrin receptor 1b expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S ( n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks

Fig. 4C

Ferritin expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 in each time point and marked by a line

Fig. 4D

Transferrin expression in strain R3 (■) and SA (■) during Trypanoplasmaborreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks

qRT–PCR primers used in this study

GenePrimerSequence (5'–3')
TfR1aFTCATACCCAGTTTCCCCCAG
RGGTATCCCGAAGCATCCCAT
TfR1bFGAGCTGGAAAAATCAGCATGG
RGGAATCCTGGGGTGTAAGGA
TfFCCCTCAGCCAGTGCTCAAAA
RATAGCATCTGCATCACCAGTC
FerFTGGAGCTGTATGCATCCTACG
RCCCTCCCCTCTGGTTCTGA
40SFCCGTGGGTGACATCGTTACA
RTCAGGACATTGAACCTCACTGTCT
Language: English
Page range: 285 - 290
Submitted on: May 16, 2018
|
Accepted on: Sep 18, 2018
|
Published on: Oct 23, 2018
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2018 Teresa Kamińska-Gibas, Ilgiz Irnazarow, Joanna Szczygieł, Patrycja Jurecka, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.