Have a personal or library account? Click to login
Cloning and expression of NS3 gene of Pakistani isolate type 2 dengue virus Cover

Cloning and expression of NS3 gene of Pakistani isolate type 2 dengue virus

Journal of Veterinary Research
Volume 62 (2018): Issue 1 (March 2018)
By: Farkhanda Yasmin,  Tahir Yaqub,  Muhammad Idrees,  Wasim Shahzad,  Abu Saeed Hashmi,  Kiran Aqil,  Nadia Mukhtar,  Muhammad Yasir Zahoor,  Naeem Akhtar and  Sajid Umar  
Open Access
|Mar 2018

Figures & Tables

Fig. 1

PCR amplification of dengue NS3 gene. Lane M – 1Kb marker; lanes 1-3 – amplified NS3 product
PCR amplification of dengue NS3 gene. Lane M – 1Kb marker; lanes 1-3 – amplified NS3 product

Fig. 2

The cloning of fragment containing NS3 region in pCR 2.1 TOPO
The cloning of fragment containing NS3 region in pCR 2.1 TOPO

Fig. 3

(a) Restriction and digestion of NS3 encoding TA vectors. b) Cloning PCR
(a) Restriction and digestion of NS3 encoding TA vectors. b) Cloning PCR

Fig. 4

Map of pcDNA3.1 mammalian expression vector
Map of pcDNA3.1 mammalian expression vector

Fig. 5

PCR amplification of NS 3 gene with restriction site specific primers. Lane 1 M – 1 kb marker, lanes 2–4 – NS3 (1,904 bp)
PCR amplification of NS 3 gene with restriction site specific primers. Lane 1 M – 1 kb marker, lanes 2–4 – NS3 (1,904 bp)

Fig. 6

Double-digested pcDNA3.1 mammalian expression vector. Lane M – 1kb marker; lanes 1 and 2 – digested pcDNA 3.1
Double-digested pcDNA3.1 mammalian expression vector. Lane M – 1kb marker; lanes 1 and 2 – digested pcDNA 3.1

Fig. 7

Double-digested amplified NS3 gene of dengue virus. Lane M – 1kb marker; lanes 1–3 – double digested NS3 gene
Double-digested amplified NS3 gene of dengue virus. Lane M – 1kb marker; lanes 1–3 – double digested NS3 gene

Fig. 8

Colony PCR (gene-specific) screening of NS3 encoding region in mammalian expression vector. Lanes 1–2 – positive NS3 encoding clones; lane M – 1kb ladder
Colony PCR (gene-specific) screening of NS3 encoding region in mammalian expression vector. Lanes 1–2 – positive NS3 encoding clones; lane M – 1kb ladder

Fig. 9

Restriction and digestion of NS-3 encoding mammalian expression vector. Lane M – 1kb marker; lanes 1–3 – positively digested plasmids
Restriction and digestion of NS-3 encoding mammalian expression vector. Lane M – 1kb marker; lanes 1–3 – positively digested plasmids

Fig. 10

pcDNA3.1 BglII linearised plasmid and empty vector. Lane M – 1kbM ladder; lanes 1 and 2 – linearised pcDNA3.1; lane M – 1kb ladder; lane 1 – linearised pcDNA3.1/NS3
pcDNA3.1 BglII linearised plasmid and empty vector. Lane M – 1kbM ladder; lanes 1 and 2 – linearised pcDNA3.1; lane M – 1kb ladder; lane 1 – linearised pcDNA3.1/NS3

Fig. 11

NS3 expressing cell line characterised by RT-PCR
NS3 expressing cell line characterised by RT-PCR

Primers used for amplification and expression of dengue virus NS3 gene_ Restriction sites were added at the start of primers

No.GenesPrimer sequence
1NS3F-1GCAAGCTTGCCATGGCCGCTGGAGTATTGTCGGC
2NS3F-2GCGGATCCGCCATGGCCGCTGTATTGTCGGC
3NS3RGCGCGGCCGCTTTCTTCCACTGCAAACTCTTTGTTC

List of bacterial strains used in the present study

No.Bacterial strainGenotype and descriptionSource
1E. coli DH 5 αF’, φ80d/lacZ.M15, recA1, endA1, gyrA96, thi-1, hsdR17(rK-, mK+), supE44, relA1, deoR, .(lacZYAargF) U169;CEMB culture Collection
2E. coli DH 5 α top10F- mcrA .(mrr-hsdRMS-mcrBC) ö80lacZ.M15 .lacX74 recA1 araD139CEMB culture Collection

List of primers used for amplification of dengue virus NS3 gene

No.Primer NamePrimer SequencesPrimer position within N2L1 sequence
1NS3-1-OFCAGGACTTTTCCCCGTATCA4419-4438
2NS3-1-IFAACAACGGGCTGGAGTATTG4482-4501
3NS3-1-SEQ-FCCAGGTCTTGGCATTAGAGC4774-4793
4NS3-2-OFTCACAGACCCAGCAAGCATA5352-5371
5NS3-2-IFAGCAGAGACCCATTTCCTCA5450-5469
6NS3-2-SEQ-IFGGCAGAAATGGGTGCTAACT5719-5738
7NS3-1-ORGGAACTCTGGACATGAGTGGGT5541-5520
8NS3-1-IRTTGAGGAAATGGGTCTCTGC5451-5470
9NS3-2-ORAGCATGATTGTACGCCCTTC6456-6475
10NS3-2-IRTGGAAGCCTACCCATTTCTG6366-6385

pcDNA3_1 vector specific primer sequences

NamePrimer sequence
T7TAATACGACTCACTATAGGG
BGHTAGAAGGCACAGTCGAGG
DOI: https://doi.org/10.2478/jvetres-2018-0003 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 17 - 26
Submitted on: Sep 19, 2017
|
Accepted on: Mar 8, 2018
|
Published on: Mar 30, 2018
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
dengue virus serotype-2,
NS3 gene,
dengue shock syndrome,
vector pcDNA
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2018 Farkhanda Yasmin, Tahir Yaqub, Muhammad Idrees, Wasim Shahzad, Abu Saeed Hashmi, Kiran Aqil, Nadia Mukhtar, Muhammad Yasir Zahoor, Naeem Akhtar, Sajid Umar, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous articleVolume 62 (2018): Issue 1 (March 2018)Next article