Complete genome sequences of three sub-genotype 2.1b isolates of classical swine fever virus in China

Liu, Chunxiao; Li, Mingliang; Yin, Xingwang; Zhang, Hongliang; Xiang, Lirun; Zhai, Hongyue; Wang, Congcong; Kan, Yunchao; Yao, Lunguang; Tian, Zhijun; Leng, Chaoliang

doi:10.2478/jvetres-2018-0002

Figures & Tables

Phylogenetic analysis of the 3 new isolates (•) and other reference CSFV isolates based on the complete genomic sequences (A) and full-length E2 gene sequences (B)

Sequence alignments of 5′UTR of the 3 new CSFV isolates and 32 reference isolates. Some mutation or deletion regions of these isolates are indicated by red boxes (□) and described in detail in the text

Sequence alignments of 3′UTR of the 3 new CSFV isolates and 11 reference isolates. Some mutation or insertion regions of these isolates are indicated by red boxes (□) and described in detail in the text

Amino acid sequence alignments of E2 genes of the 3 new CSFV isolates and 33 reference isolates. The special mutation positions of these isolates are indicated by red boxes (□) and described in detail in the text

The genome homology of SD2014-1, SD2014-2, and SD2014-3 (%)

Strains	SD2014-1	SD2014-2	SD2014-3
SD2014-1	–	97.7	98.6
SD2014-2	97.7	–	97.9
SD2014-3	98.6	97.9	–

Detailed comparison of the full-length genomes of SD2014-1, SD2014-2, and SD2014-3 to other representative CSFV isolates (%)

Nucleotides	Shimen (1.1)^a	Paderborn (2.1a)^a	HEBZ (2.1b)^a	HNSD-2012 (2.1c)^a	JSZL (2.1d)^a	CSFV39 (2.2)^a	Alfort/ Tuebingen (2.3)^a	94.4/IL/94/T-WN (3.4)^a
5′UTR	94.1^∗	97.1^∗	98.1^∗	96.2^∗	96.8^∗	94.4^∗	94.6^∗	91.4^∗
	92.8^∗∗	98.1^∗∗	96.8^∗∗	96.5^∗∗	97.1^∗∗	93.0^∗∗	95.4^∗∗	92.8^∗∗
	93.3^∗∗∗	97.6^∗∗∗	97.3^∗∗∗	96.0^∗∗∗	97.6^∗∗∗	93.8^∗∗∗	94.1^∗∗∗	92.2^∗∗∗
N^pro	87.1	94.2	95.6	92.9	95.6	87.5	87.9	85.3
	86.9	93.3	94.6	92.1	94.6	87.3	87.5	84.3
	86.9	94.0	95.4	93.1	95.8	88.1	88.5	85.1
C	84.2	94.6	93.6	90.6	95.6	89.2	90.9	84.2
	83.8	94.9	93.3	90.9	95.3	89.6	91.2	83.8
	84.2	94.3	92.6	90.2	94.6	88.9	90.6	84.5
E^rns	84.1	93.0	94.3	92.7	95.0	89.3	90.3	83.1
	84.7	92.5	94.0	92.5	94.9	89.0	90.0	83.4
	84.1	92.5	93.8	92.8	94.6	88.8	90.2	83.7
E1	85.3	93.5	94.5	91.1	94.7	89.1	88.9	81.0
	85.3	93.8	95.2	91.5	95.4	90.8	88.9	81.9
	85.1	94.0	94.7	91.6	95.2	89.9	89.4	81.7
E2	83.3	93.7	93.9	90.2	93.7	87.7	87.8	81.5
	83.6	93.7	94.3	90.2	93.7	87.9	87.9	81.9
	83.6	93.8	94.1	90.3	93.7	87.7	88.0	81.4
P7	79.2	95.2	96.6	94.2	93.7	89.9	89.9	86.0
	81.2	95.2	96.1	94.2	94.2	89.9	89.4	87.0
	80.2	95.2	96.1	94.2	93.2	89.9	89.4	87.0
NS2	82.8	92.7	94.5	91.1	93.8	88.3	88.0	80.4
	82.5	93.1	94.7	91.2	93.4	88.0	88.4	80.1
	82.9	93.0	94.7	91.5	93.8	88.4	88.3	80.2
NS3	86.9	94.9	95.2	93.4	95.5	90.7	90.9	85.8
	86.5	94.7	94.9	93.2	95.3	90.6	90.6	85.2
	97.0	95.1	95.2	93.3	95.7	90.8	91.2	85.4
NS4A	87.8	96.3	95.2	91.0	95.8	90.5	91.5	83.1
	87.3	95.2	94.2	92.1	94.7	88.4	88.4	85.2
	89.4	95.8	94.7	91.5	95.2	89.9	91.0	83.6
NS4B	87.8	93.1	94.6	91.0	94.1	90.0	88.8	84.2
	88.0	93.7	95.0	91.9	95.1	90.6	89.2	85.0
	88.1	93.8	95.3	91.6	94.6	89.9	89.3	84.6
NS5A	85.2	93.2	94.4	91.0	93.6	85.2	90.1	82.3
	85.5	93.4	94.7	90.9	93.8	85.4	90.1	82.4
	85.5	93.4	94.7	90.8	94.0	85.3	90.0	82.5
NS5B	85.0	94.2	95.0	92.5	94.9	85.4	90.1	83.2
	85.1	94.7	95.6	92.7	95.2	85.6	90.4	83.6
	85.0	94.8	95.6	93.2	95.3	85.4	90.4	83.4
3′UTR	85.9	95.7	95.3	93.4	96.1	85.5	95.3	81.9
	85.0	94.8	94.4	93.4	96.1	84.6	94.4	81.9
	84.1	93.5	93.1	93.4	94.8	83.7	93.1	81.1
Complete	85.5	94.0	94.9	92.0	94.7	88.2	89.8	83.4
	85.5	94.1	94.9	92.1	94.7	88.3	89.8	83.6
	85.5	94.2	95.0	92.3	94.8	88.2	90.0	83.5
Amino acid
N^pro	92.9	97.0	95.2	95.8	96.4	93.5	90.5	91.7
	93.5	96.4	94.6	95.2	95.8	92.9	91.1	91.1
	92.9	97.0	95.2	95.8	96.4	93.5	91.7	91.7
C	91.9	94.9	97.0	92.9	97.0	93.9	92.9	88.9
	90.9	94.9	94.9	92.9	94.9	93.9	92.9	88.9
	90.9	94.9	94.9	92.9	94.9	93.9	92.9	88.9
E^rns	89.9	97.4	97.8	98.2	98.2	95.2	96.0	91.2
	89.9	97.4	97.8	98.2	98.2	95.2	96.0	91.2
	89.9	96.5	96.9	97.4	97.4	94.3	95.2	91.2
El	92.3	96.4	95.9	94.9	96.4	96.4	96.4	89.2
	93.8	97.4	96.9	95.9	97.4	97.4	97.4	90.8
	93.8	97.4	96.9	95.9	97.4	97.4	97.4	90.8
E2	88.5	95.2	95.7	94.6	95.7	90.1	92.2	88.2
	89.8	96.0	95.7	95.4	95.7	91.4	93.2	89.0
	89.5	96.0	96.5	95.7	96.5	90.9	93.0	89.0
P7	91.3	98.6	95.7	97.1	94.2	95.7	95.7	95.7
	92.8	98.6	95.7	97.1	94.2	95.7	95.7	94.2
	91.3	98.6	95.7	97.1	94.2	95.7	95.7	95.7
NS2	90.6	97.6	97.2	96.9	96.1	95.4	94.7	88.0
	90.8	97.8	97.4	96.7	95.8	95.4	95.0	88.2
	90.6	97.4	97.4	96.7	95.8	95.4	95.0	88.2
NS3	98.4	99.4	98.8	98.8	99.4	98.7	99.1	98.5
	98.1	99.1	98.5	98.5	99.1	98.4	98.8	98.2
	98.4	99.4	98.8	98.8	99.4	98.7	99.1	98.5
NS4A	98.4	100	98.4	95.2	100	96.8	100	95.2
	98.4	100	98.4	95.2	100	96.8	100	95.2
	98.4	100	98.4	95.2	100	96.8	100	95.2
NS4B	96.0	98.3	98.8	99.1	98.6	96.8	98.3	93.9
	96.0	98.3	98.8	99.1	98.6	96.8	98.3	93.9
	95.7	98.0	98.6	98.8	98.3	96.5	98.0	93.7
NS5A	88.6	95.0	95.4	93.2	95.2	88.2	93.4	86.9
	89.2	95.2	95.6	93.4	95.2	88.8	93.2	87.3
	88.8	95.0	95.4	93.2	95.6	88.4	93.0	86.7
NS5B	91.8	96.5	96.6	96.4	97.5	92.5	95.8	89.4
	91.9	97.1	97.6	97.2	98.5	92.6	95.9	89.4
	92.6	97.8	97.9	97.6	98.7	93.3	96.6	90.1

Primers used for amplification of gene fragments of CSFV SD2014-1, SD2014-2, and SD2014-3

Fragment	Primer sequence (5′-3′) The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome	Position in genome The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome	Product size (bp) The primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome
CSFV-A	GTATACGAGGTTAGTTCATTCTCGT	1–2,047	2,047
CSFV-A	GATTACCAGAGAAAGCAACAAGAAT	1–2,047	2,047
CSFV-B	GATAATAGGCCCCGGTAAATTTGAC	2,023–3,313	1,291
CSFV-B	TTTCCTTACAGGTCCCTCGCTAGAG	2,023–3,313	1,291
CSFV-C	AAATGAGACGGGTTACAGGGTA	3,124–4,771	1,648
CSFV-C	CATCCCGTAGATCTCTTCACCTCCA	3,124–4,771	1,648
CSFV-D	CATAGATGAAATAGCTGGCGGGACC	4,564–7,171	2,608
CSFV-D	TAGTGCTCTGCCAGCCTCCACAGTG	4,564–7,171	2,608
CSFV-E	TCTGCTGATATCAGAGGAGCTG	6,866–668	2,803
CSFV-E	GCTTACCCAGACTTAATGTTTCTAG	6,866–668	2,803
CSFV-F	GCCCTATGTAAGGTCGACACCGCTC	9,572–12,296	2,725
CSFV-F	GGGCCGTTAGGAAATTACCTTAGTC	9,572–12,296	2,725

Complete genome sequences of three sub-genotype 2.1b isolates of classical swine fever virus in China

Figures & Tables

Fig. 1

Fig. 2

Fig. 3

Fig. 4

The genome homology of SD2014-1, SD2014-2, and SD2014-3 (%)

Detailed comparison of the full-length genomes of SD2014-1, SD2014-2, and SD2014-3 to other representative CSFV isolates (%)

Primers used for amplification of gene fragments of CSFV SD2014-1, SD2014-2, and SD2014-3

Paradigm

My account